ID: 958729725

View in Genome Browser
Species Human (GRCh38)
Location 3:97948990-97949012
Sequence AGGCACCTGTGCCTTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958729720_958729725 26 Left 958729720 3:97948941-97948963 CCATCCAAAAGTATGTTATATCA 0: 1
1: 0
2: 1
3: 20
4: 215
Right 958729725 3:97948990-97949012 AGGCACCTGTGCCTTGGAGAAGG 0: 1
1: 0
2: 1
3: 30
4: 311
958729723_958729725 -4 Left 958729723 3:97948971-97948993 CCTAAATCTGTCATAAATTAGGC 0: 1
1: 0
2: 2
3: 14
4: 178
Right 958729725 3:97948990-97949012 AGGCACCTGTGCCTTGGAGAAGG 0: 1
1: 0
2: 1
3: 30
4: 311
958729721_958729725 22 Left 958729721 3:97948945-97948967 CCAAAAGTATGTTATATCATTTG 0: 1
1: 0
2: 1
3: 45
4: 443
Right 958729725 3:97948990-97949012 AGGCACCTGTGCCTTGGAGAAGG 0: 1
1: 0
2: 1
3: 30
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958729725 Original CRISPR AGGCACCTGTGCCTTGGAGA AGG Intronic