ID: 958730102

View in Genome Browser
Species Human (GRCh38)
Location 3:97952277-97952299
Sequence CAGCCTGGACACATTGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958730097_958730102 10 Left 958730097 3:97952244-97952266 CCAGCATCACTGTCCAAGACACA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 958730102 3:97952277-97952299 CAGCCTGGACACATTGATCATGG 0: 1
1: 0
2: 0
3: 13
4: 177
958730099_958730102 -3 Left 958730099 3:97952257-97952279 CCAAGACACAGGTCAAAATCCAG 0: 1
1: 0
2: 0
3: 23
4: 255
Right 958730102 3:97952277-97952299 CAGCCTGGACACATTGATCATGG 0: 1
1: 0
2: 0
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958730102 Original CRISPR CAGCCTGGACACATTGATCA TGG Intronic
900711341 1:4116529-4116551 GATCCTGGACACCTTGATCCTGG - Intergenic
901335335 1:8444193-8444215 CAGCCTGGGCAAACTGATGAGGG - Intronic
901919293 1:12524995-12525017 CACTTTGGACACATTGAACATGG + Intergenic
904033756 1:27548497-27548519 CAGCCTGGAGAAACTGATGATGG - Exonic
908415976 1:63913737-63913759 CAGCCTGGACAGCTTGTTTATGG - Intronic
908527601 1:65002770-65002792 CAGACTGGCCACATCGATCGTGG - Intergenic
910878083 1:91896467-91896489 CTGCCTGGACAAATTGGTCCCGG - Intronic
911684957 1:100765084-100765106 CAGGCTGGAGACAGTGATTAAGG + Intergenic
914965394 1:152253058-152253080 CACCATGGACACTTTGTTCATGG + Intergenic
916326127 1:163561967-163561989 CAGTGTGGATACATGGATCAGGG + Intergenic
916942376 1:169689298-169689320 CAGCCCAGGCACATTGATCTTGG + Intronic
924953114 1:248903627-248903649 TATCCTGGACCCATTAATCATGG + Intergenic
1063070084 10:2652734-2652756 CAGCCTGAAGACCTTGACCAAGG + Intergenic
1063258725 10:4358838-4358860 CAGTGTGGACATATTGATAAGGG + Intergenic
1063294203 10:4786448-4786470 CATCCTAGACACATTTATAATGG - Intergenic
1063391496 10:5652646-5652668 CAGCCTGAGCAAATTGATGATGG - Intronic
1063689484 10:8272709-8272731 CAGCCAGGAGACATTGGGCAAGG + Intergenic
1064830620 10:19461927-19461949 GAGCCTGGACACATTGTTGCAGG + Intronic
1073036875 10:100570082-100570104 CAGCCGGGACACTTTCATCTCGG - Intergenic
1074364693 10:112848555-112848577 CAGGCTGGAGACACAGATCATGG + Intergenic
1075397755 10:122140276-122140298 CAGCCATGACTTATTGATCAAGG - Intronic
1075718549 10:124571506-124571528 CATCCTGGACACCTTGTGCAGGG - Intronic
1080839977 11:35975133-35975155 CAGCCTGGAGACATGGATTATGG - Intronic
1082999774 11:59280687-59280709 CACCATGGACACTTTGTTCATGG - Intergenic
1083263606 11:61536099-61536121 CATCCTGGAAACATTTCTCATGG - Intronic
1083603032 11:63960843-63960865 CAGCCTGGTCCCATTTCTCAGGG - Intergenic
1084258232 11:67956755-67956777 CATCCTGGGCTCATTCATCAGGG - Intergenic
1084684980 11:70688070-70688092 CAGCCTGGACACCCTCATGACGG - Intronic
1085463799 11:76710765-76710787 CAGCCTGGCCACGTTGGCCAAGG + Intergenic
1085748451 11:79136401-79136423 CACCATGGCCACATTGTTCATGG - Intronic
1086148768 11:83585274-83585296 CAGGATGGAGACATTGATCTGGG + Intronic
1092016895 12:5167093-5167115 CAGCCTGGACAGAGTGCTTAGGG + Intergenic
1092428480 12:8391556-8391578 CATCCTGGGCTCATTCATCAGGG - Intergenic
1094389677 12:29935399-29935421 CACCATGGACACTTTGTTCATGG + Intergenic
1095722657 12:45417552-45417574 CAGCCTGTATTCATTGATTATGG + Intronic
1098997636 12:77139706-77139728 CATCCTGGATACAGGGATCATGG - Intergenic
1101454451 12:104815730-104815752 CAGCCTGGAAACCTGGATTAGGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103843222 12:123882331-123882353 CAGCCTGCACACACAGATCTGGG + Intronic
1103879066 12:124152152-124152174 CAGCCTGGACACACTCTCCAGGG + Intronic
1104272126 12:127292130-127292152 ATGCCTGCACACATTGATGAGGG - Intergenic
1104632760 12:130418276-130418298 CAGCCTGGAGAAATTAATGAAGG - Intronic
1105881785 13:24612352-24612374 CAGCCTGGAAAGATTGAGGAAGG + Intergenic
1106958115 13:34965729-34965751 CATCCAGGAGACCTTGATCATGG - Intronic
1109099011 13:58155847-58155869 CAGCTTAGACACCTTTATCAGGG - Intergenic
1111583762 13:90258302-90258324 CAGCATGGAGGCATTGATGATGG - Intergenic
1112954508 13:105041777-105041799 CATCCGGGACACATTGATGCAGG + Intergenic
1116777693 14:49200709-49200731 GAGCATGGCCACATTGATTAGGG - Intergenic
1121715083 14:96068091-96068113 CAGCATGGAAACATTAGTCAAGG + Intronic
1122558103 14:102592327-102592349 CTGCCTGGAGAGATGGATCATGG + Intergenic
1123503487 15:20913783-20913805 AATCATGGCCACATTGATCACGG - Intergenic
1123560734 15:21487448-21487470 AATCATGGCCACATTGATCACGG - Intergenic
1124192290 15:27590882-27590904 CAGCCTTGCCTCTTTGATCAGGG - Intergenic
1124200555 15:27675277-27675299 CAGTCTGGATAAATGGATCAAGG + Intergenic
1126671354 15:51118244-51118266 AAGCCTGGACACATGGATCTGGG + Intergenic
1129329077 15:74817585-74817607 CAGCCTGGTCACATTGTCCTTGG + Intronic
1130213889 15:81950742-81950764 CATCCTGAACACATAGACCAAGG - Intergenic
1202969081 15_KI270727v1_random:214612-214634 AATCATGGCCACATTGATCACGG - Intergenic
1136013098 16:27377394-27377416 CATCATGGACACATTGACCGAGG - Intergenic
1137963857 16:52911838-52911860 AAGCCTGGCCTCATTGACCATGG - Intergenic
1140135877 16:72205078-72205100 CAGCCTAGACACACTGAGGATGG - Intergenic
1144378150 17:14666081-14666103 CAGCCTGGACTCTGTGCTCAGGG + Intergenic
1144869080 17:18357548-18357570 CAGTCTGGACACATTTCTCCAGG + Intronic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1147487893 17:40836015-40836037 CAGCCTCAACACAGTGATAAAGG + Exonic
1152345052 17:79746490-79746512 CAGCCTTGAGATAGTGATCAAGG + Intergenic
1153217572 18:2834782-2834804 CACCATGGCCACATTGTTCATGG + Intergenic
1155100715 18:22607546-22607568 CAGCCTTGACACAAGGATCCAGG + Intergenic
1163638235 19:18447475-18447497 CATCATGGACACTTTGCTCATGG - Intronic
1164526698 19:29018304-29018326 CAGCATGGAGGGATTGATCAGGG - Intergenic
1164640527 19:29822018-29822040 CAGCCAGGACACAATAGTCAGGG - Exonic
1164662305 19:29986511-29986533 CAGCCTGGATTCATAGATCACGG - Intronic
1165804230 19:38570827-38570849 CAGGCTGGACACCTGGATCCTGG + Intronic
925190961 2:1883065-1883087 CAGCCTGGACTGAGTCATCACGG - Intronic
925556741 2:5139407-5139429 CATCCTGCAGACATGGATCAAGG + Intergenic
926492713 2:13544485-13544507 CTCCCTGGACACATGGATTATGG - Intergenic
926730930 2:16034846-16034868 CTGTTTGGACACATTGATCAAGG + Intergenic
926772360 2:16389723-16389745 CAGGCTGGACACATGGCTCAGGG - Intergenic
926810280 2:16749857-16749879 CAGCATGGCCACTTTGTTCATGG + Intergenic
930638225 2:53828981-53829003 CAGCCTGGGCACATTGGGCAGGG + Intergenic
931506360 2:62931732-62931754 CAGCATGGATACATTGGACAAGG - Intronic
932815304 2:74856325-74856347 CAGCCTGGACCCAGTGCTGAGGG + Intronic
939335672 2:140825124-140825146 CAGCCTGGTCACAGAGGTCAGGG + Intronic
941653394 2:168117778-168117800 AAGCCTGGAGACATAGACCATGG + Intronic
941706616 2:168664979-168665001 AAGCCTGGAGACAGTGATCCAGG - Intronic
942402622 2:175619542-175619564 CACCCTAGACACATTAATTAGGG - Intergenic
944320488 2:198335427-198335449 CAGGCTGCTCACATTGATCAGGG - Intronic
947372904 2:229466547-229466569 CAGCATGGACAGTATGATCAGGG - Intronic
947994182 2:234512961-234512983 CCGCCTGGACACACTCAACAGGG - Intergenic
948795428 2:240399993-240400015 CAGCCTGGACACAGGACTCAGGG + Intergenic
1171379585 20:24724263-24724285 TAGCCTGGACCCAGTGATAAAGG - Intergenic
1172056521 20:32158107-32158129 CAACCTGGTCACCTTGATCTTGG - Intronic
1172386703 20:34539026-34539048 CAAACTGCAAACATTGATCAAGG - Intronic
1173480562 20:43395616-43395638 CAGCCTTGAAACCTTGAGCAAGG + Intergenic
1174494178 20:50928530-50928552 CAGCCTAGCCACATTCCTCAAGG - Intronic
1178639612 21:34335519-34335541 CAGCATGGTCGCATTCATCATGG + Intergenic
1179982726 21:44905071-44905093 CAGCATGGCCACATTGCTCGTGG - Intronic
1183825981 22:40387967-40387989 CAGACTGGAAACATATATCAGGG - Intronic
1184788650 22:46685366-46685388 CAGCCGGGAAACATTTACCAGGG + Exonic
950190621 3:10973938-10973960 CAGCCTGGACCCATTGAAAAAGG - Intergenic
950655337 3:14432913-14432935 CAGCCTGGACACACAGAGGAAGG - Intronic
951624529 3:24645147-24645169 CAGCCTGGGCACAGGGCTCAGGG + Intergenic
954795309 3:53158394-53158416 CAGGCTAGACACATTGCCCAGGG - Intronic
955166458 3:56519123-56519145 CAACCTGGAAAAATTTATCATGG - Intergenic
955476367 3:59340430-59340452 CAGCATGGCCACAGTGATCAGGG + Intergenic
957014595 3:75048222-75048244 GAGCCTGGACACCTTGTTAAGGG + Intergenic
957073184 3:75581271-75581293 CATCCTGGGCTCATTCATCAGGG - Intergenic
958487563 3:94731653-94731675 CACCGTGGCCACATTGTTCATGG + Intergenic
958730102 3:97952277-97952299 CAGCCTGGACACATTGATCATGG + Intronic
959718079 3:109455671-109455693 CAGCCTGCACAAGTTGATCTTGG + Intergenic
960246332 3:115404340-115404362 CACCCTGGACATATTGAACCAGG - Intergenic
960340929 3:116474265-116474287 CAGCCTGTTCCCATTGCTCATGG + Intronic
961280899 3:125765509-125765531 CATCCTGGGCTCATTCATCAGGG + Intergenic
961873493 3:130004076-130004098 CATCCTGGGCTCATTCATCAGGG - Intergenic
962223198 3:133581610-133581632 CAGCCAGGAAACTTTGAACATGG - Intronic
962529476 3:136265758-136265780 AACCCTGAACACATTGCTCATGG - Intronic
963273430 3:143307735-143307757 CAGGCTGGAGACCTTGATCCAGG - Intronic
967258716 3:187620634-187620656 CATCCTGGCCACATTCATGATGG - Intergenic
967364534 3:188670862-188670884 CAACGAGGACACATTAATCATGG - Intronic
969737180 4:8999750-8999772 CATCCTGGGCTCATTCATCAGGG + Intergenic
969796371 4:9531338-9531360 CATCCTGGGCTCATTCATCAGGG + Intergenic
970606166 4:17683879-17683901 CAGCCTGGACAGCATGATGAAGG + Intronic
970705789 4:18800507-18800529 AAGACTGGACAGATGGATCAGGG - Intergenic
971420520 4:26469993-26470015 CAGCATGGCCTCATTGAACAGGG - Intergenic
971938856 4:33188923-33188945 CAGCCTGGACCCATGGATGGAGG - Intergenic
974727333 4:65813358-65813380 CACCATGGCCACATTGTTCACGG - Intergenic
976980778 4:91224710-91224732 TAGGCTGGACACATTTATAAAGG - Intronic
979953475 4:126924840-126924862 CAGCCTGGATAGATTTTTCAAGG - Intergenic
980196565 4:129596320-129596342 CAGAGTGGAGAAATTGATCATGG - Intergenic
988739805 5:34059174-34059196 CACCCTGTACACCTTGATCTTGG - Intronic
988812519 5:34799589-34799611 CATCCTGAAGACATTAATCATGG - Intronic
990033337 5:51289193-51289215 CAGACTGGACACAATTATGATGG - Intergenic
990468950 5:56095638-56095660 CACACTGGAGACATTGCTCATGG + Intergenic
994212868 5:97105752-97105774 TAGCCTGGAGACATGGATCATGG + Intronic
995291985 5:110467786-110467808 CCATGTGGACACATTGATCATGG - Intronic
995427621 5:112042929-112042951 CACCATGGCCACTTTGATCATGG + Intergenic
1000771337 5:165358480-165358502 CAGCCTGGTTACATTGCTCCGGG + Intergenic
1001263661 5:170256004-170256026 AACCATGGACAGATTGATCATGG + Intronic
1001499423 5:172217685-172217707 CAGCCTGGACAACATGAACATGG - Intronic
1002763218 6:217782-217804 CAGCCTGGTGACTTTGACCATGG - Intergenic
1005905868 6:30261053-30261075 CAGCCTGGACACAGGAATCTGGG - Intergenic
1006037559 6:31225407-31225429 CAGCCAGGACACAGTGGCCAGGG - Intergenic
1007308159 6:40923339-40923361 CAGCCTGGCCAGGTTGATCTGGG - Intergenic
1007725829 6:43915071-43915093 CAGCCTGGGCACATGGAGGAGGG + Intergenic
1009851805 6:69208134-69208156 CACCATGGCCACATTGTTCATGG + Intronic
1012023428 6:93956494-93956516 CTTCCTTGACACATTGACCAGGG + Intergenic
1014139543 6:117925678-117925700 CAGTCTGGACACATCTGTCAAGG + Intronic
1016887891 6:148975492-148975514 CACACTGGACACTTTGATCATGG - Intronic
1020131398 7:5560697-5560719 CAGCCAGGAAACTTTGATTAAGG + Intronic
1023875169 7:44282851-44282873 CAGCCTGGCCAGATGGGTCAGGG + Intronic
1024090516 7:45936052-45936074 CAGCCTGCACAAATAGACCAAGG - Intergenic
1024378315 7:48664493-48664515 CAGCCTGGTCACCTAAATCAGGG - Intergenic
1027638240 7:80702493-80702515 AAGACTGGACAAATTTATCAGGG - Intergenic
1027806059 7:82824328-82824350 CAGACTGAAAGCATTGATCATGG - Exonic
1029075257 7:97929365-97929387 CATCCTGGGCTCATTCATCAGGG - Intergenic
1029485211 7:100836139-100836161 CAGCCAGGACACAATAGTCAGGG - Intronic
1033645031 7:143294746-143294768 CAGTCTGGTCACATAGAACATGG - Exonic
1035969645 8:4233603-4233625 CAACCAGGACACCTTGATCTTGG + Intronic
1036242267 8:7091013-7091035 CATCCTGGGCTCATTCATCAGGG + Intergenic
1036258525 8:7222999-7223021 CATCCTGGGCTCATTCATCAGGG - Intergenic
1036307043 8:7610381-7610403 CATCCTGGGCTCATTCATCAGGG + Intergenic
1036308096 8:7616509-7616531 CATCCTGGGCTCATTCATCAGGG + Intergenic
1036310580 8:7681595-7681617 CATCCTGGGCTCATTCATCAGGG - Intergenic
1036357890 8:8058368-8058390 CATCCTGGGCTCATTCATCAGGG + Intergenic
1036358952 8:8064510-8064532 CATCCTGGGCTCATTCATCAGGG + Intergenic
1036830469 8:12016117-12016139 CATCCTGGGCTCATTCATCAGGG - Intergenic
1036892006 8:12602442-12602464 CATCCTGGGCTCATTCATCAGGG - Intergenic
1036893059 8:12608578-12608600 CATCCTGGGCTCATTCATCAGGG - Intergenic
1036899554 8:12660417-12660439 CATCCTGGGCTCATTCATCAGGG - Intergenic
1036900619 8:12666564-12666586 CATCCTGGGCTCATTCATCAGGG - Intergenic
1039895759 8:41715411-41715433 CAGCCTTCATACATTTATCATGG - Intronic
1043264911 8:78253725-78253747 CAAGCTGGACAAATTGATGAAGG + Intergenic
1043785494 8:84393383-84393405 CAGCCTGCACTCTTTGATGAAGG - Intronic
1044384882 8:91576031-91576053 CAGCCTTGAGACATTGATGCTGG + Intergenic
1046128559 8:109940776-109940798 CACCATGGACACTTTGTTCATGG + Intergenic
1046974759 8:120262000-120262022 CAACCTGGACCCATGGACCAGGG + Intronic
1047390423 8:124446259-124446281 CAGCCTGGGCAACTTGAGCAAGG - Intergenic
1048559857 8:135522519-135522541 CAGCCTGCACACATTGTTTGTGG - Intronic
1051947685 9:22591113-22591135 CAGCCGGGACACAGTGATCCTGG + Intergenic
1057608604 9:96520394-96520416 CAGGCTGGATGCAGTGATCATGG + Intronic
1062263160 9:135673366-135673388 CAGCCTGGTGACACTGATCCTGG - Intergenic
1203792487 EBV:159306-159328 CAGCCTGTACACCTTCATCACGG - Intergenic
1185932528 X:4219015-4219037 CAGCCAGTACACACTGATGAAGG - Intergenic
1186168548 X:6853199-6853221 CAGCCTGTAGACATAGATAAGGG - Intergenic
1186261107 X:7780613-7780635 CAGCATGGACACATGGTCCACGG + Intergenic
1187553677 X:20331039-20331061 CAGCCTGGAAATATAGAACAAGG - Intergenic
1189284170 X:39840019-39840041 AAGCCAGGACAGATTTATCAGGG - Intergenic
1190728903 X:53211694-53211716 CACCCTGGACCCACTGATCCAGG + Intronic
1192298667 X:69878008-69878030 CAGAATGAACACATAGATCAAGG - Intronic
1196651547 X:118173228-118173250 CAGCCTGAGCACATTGAAGATGG - Intergenic
1201943568 Y:19484834-19484856 CGGCCTGGAAGCACTGATCATGG - Intergenic