ID: 958730362

View in Genome Browser
Species Human (GRCh38)
Location 3:97954409-97954431
Sequence GATGGTCACGTGAGTAGAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958730357_958730362 26 Left 958730357 3:97954360-97954382 CCTAGCATGTGCAGCTGGGAGGC 0: 1
1: 0
2: 2
3: 25
4: 292
Right 958730362 3:97954409-97954431 GATGGTCACGTGAGTAGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958730362 Original CRISPR GATGGTCACGTGAGTAGAGT GGG Exonic
905920392 1:41715243-41715265 GATGGTCAGGAGAGAAGAGCAGG + Intronic
907386491 1:54129011-54129033 GGGGGTCACGTGAGTAGAAAGGG + Intergenic
907645717 1:56241184-56241206 GAGGGTCACTTGAGCAGAGGAGG + Intergenic
910526777 1:88187829-88187851 GATGGTCATATAAATAGAGTTGG + Intergenic
918327658 1:183425822-183425844 GATGGGCACGTGATCAGTGTAGG - Intergenic
921338889 1:214114643-214114665 GAGGGTCAGGTGAGTAGGGAGGG + Intergenic
1062945494 10:1458164-1458186 GATGGACACGTGCCTAGAGAGGG - Intronic
1067840998 10:49679545-49679567 GAGGGTCACGTGAGCAGCTTGGG + Intergenic
1068230494 10:54165254-54165276 GATGGGCACCTCAGTAGGGTAGG + Intronic
1072050485 10:91698874-91698896 GATGCTCACTTGATGAGAGTGGG - Intergenic
1081865246 11:46356141-46356163 GACGGTCACCAGAGAAGAGTGGG + Intronic
1084617723 11:70247518-70247540 GCTTGTCATGTGAGCAGAGTGGG - Intergenic
1085963001 11:81485088-81485110 GATGGTCACCATAGTATAGTTGG + Intergenic
1086230414 11:84562840-84562862 GAGGGTCACTTGAGCACAGTTGG - Intronic
1086894225 11:92293647-92293669 GATGGTCACATGGGTAGAGATGG + Intergenic
1088384984 11:109244163-109244185 GATGGTTATGTGTGTAGAGCAGG + Intergenic
1099089372 12:78285516-78285538 GATGGTGACGTTATTAGACTTGG + Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1112334197 13:98500625-98500647 GATGGTCACGGGAGTGGTGGGGG - Intronic
1115764144 14:36605352-36605374 GATGGTCAGGGAAGTAGGGTTGG + Intergenic
1118616763 14:67579338-67579360 GATGGTGACGTGAGAAGACTCGG - Intronic
1123817742 15:23996814-23996836 GATGGTCACCTCAGCAGAGGAGG - Intergenic
1125796089 15:42404947-42404969 GCACGTCACGTGAGTAGAGCAGG + Intronic
1134808789 16:17149062-17149084 GATGCTCAGCTGAGTAGATTTGG - Intronic
1137812856 16:51369543-51369565 GATGGGCATGTGACTAGTGTTGG - Intergenic
1143957548 17:10684430-10684452 GAGGGGCAGTTGAGTAGAGTTGG + Intronic
1153262277 18:3236136-3236158 CATAGTCACGTAAGTAGAGGTGG + Intergenic
1154232330 18:12568449-12568471 GATGGACAGATGAGTGGAGTTGG - Intronic
1161185009 19:2911736-2911758 AATGGACACATGAGTAGACTGGG - Intronic
1162064489 19:8116906-8116928 GATGGTCACTCGAGTAGTCTGGG + Intronic
1163254700 19:16148710-16148732 GAAGGTCACCTGGGTAGAGAAGG - Exonic
1168519396 19:57036511-57036533 GATGACCACGTGAGGAGAGGAGG + Intergenic
927625224 2:24709476-24709498 AATGGTCACGAGACTAGACTAGG - Intronic
929008214 2:37415914-37415936 GATGGTCAGAAGAATAGAGTGGG - Intergenic
930729020 2:54709695-54709717 GCTGGTCCCGTGATCAGAGTGGG + Intergenic
932693831 2:73936964-73936986 GTTGGTCAGGTGAGGAGAGGAGG + Intronic
933727348 2:85434381-85434403 GATGGTCAGGGGAGAAGAGAGGG + Intronic
936609880 2:113991908-113991930 GATGGAAAACTGAGTAGAGTGGG + Intergenic
939877981 2:147599434-147599456 GAGGGTAAGGTGAGTAGAGGTGG - Intergenic
940223339 2:151376504-151376526 GATGGAGAGGTGAGGAGAGTAGG - Intronic
944977825 2:205077149-205077171 GATTGTCAGGTGAGTAGAGAGGG + Intronic
945299622 2:208203764-208203786 GATGGTCAAGGGATTTGAGTTGG + Intergenic
946304903 2:218850931-218850953 GGTAGACACGTGAGTACAGTGGG + Intergenic
953481016 3:43252205-43252227 GATTTTCACATGACTAGAGTAGG - Intergenic
957444278 3:80294865-80294887 GCGGGTCACTTGAGTAGAGGAGG - Intergenic
958730362 3:97954409-97954431 GATGGTCACGTGAGTAGAGTGGG + Exonic
962864002 3:139431797-139431819 GATGGTCAGGTGTGGACAGTAGG + Intergenic
972031366 4:34463373-34463395 GATGGTGAATTGGGTAGAGTGGG + Intergenic
972302110 4:37794136-37794158 GATGGGCAGGGGAGTAGGGTAGG + Intergenic
977065317 4:92305752-92305774 GATTAGCAAGTGAGTAGAGTTGG - Intronic
977243280 4:94599972-94599994 GATGGTGAAGTGATTAGATTAGG + Intronic
978459917 4:108940420-108940442 GGGGGTCAAGTGAGTGGAGTGGG - Intronic
982646791 4:158033970-158033992 GATGGTAGCCTGAGGAGAGTGGG - Intergenic
982758420 4:159251378-159251400 GCTGGGCTCCTGAGTAGAGTGGG + Intronic
987186446 5:15425311-15425333 GAAGGTCACCTGGGTAGACTAGG - Intergenic
987608283 5:20167742-20167764 GAAGATCCCTTGAGTAGAGTAGG + Intronic
988238410 5:28575855-28575877 GATTGGCACTTGAGTAGAGCAGG + Intergenic
999655750 5:153808864-153808886 GAAGGTCACATCATTAGAGTTGG - Intronic
1006065838 6:31462219-31462241 GATGGTCACGTGAGTGCTGCTGG - Intergenic
1008042738 6:46819026-46819048 GAAGATCACCTGAGTAGAGGAGG + Intronic
1020071065 7:5227336-5227358 GCTAGCCACGTGAGTAGAGCCGG + Exonic
1022133281 7:27423765-27423787 GGTGGTCAGTTGAGTAGACTGGG + Intergenic
1026550719 7:71366126-71366148 GGTGGTCACGTGAGTAGATGGGG + Intronic
1031177544 7:118371769-118371791 GATGGCCAGGTGAGGAGACTGGG + Intergenic
1032800395 7:135313028-135313050 GATGGGGAGGTGAGTGGAGTGGG + Intergenic
1056545862 9:87612863-87612885 GATGGTCACCTGAGTAGCTCTGG + Intronic
1057304527 9:93904522-93904544 GATGAGCACTTGAGTAGAGAAGG - Intergenic
1062195305 9:135269811-135269833 TGTGGGCACGTGTGTAGAGTGGG - Intergenic
1203776964 EBV:78498-78520 GGTAGGCACGTGAGTAGAGCTGG + Intergenic
1197013797 X:121599327-121599349 GATGGTCACATGAGAAGAATTGG + Intergenic