ID: 958732396

View in Genome Browser
Species Human (GRCh38)
Location 3:97972869-97972891
Sequence CCTTTTATGAATAGAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 229}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958732396 Original CRISPR CCTTTTATGAATAGAGAAGC AGG Intergenic
900984242 1:6064399-6064421 CTTTTTATAAATAGGGAAGGGGG + Intronic
902389231 1:16093016-16093038 CCCTTTATTAGTAGAGAACCAGG - Intergenic
904011407 1:27392485-27392507 CTTTTTATGAATGGGGGAGCGGG + Intergenic
906925399 1:50110502-50110524 CTTTTTCTGAAAAAAGAAGCAGG + Intronic
907727230 1:57030811-57030833 CCTTTTATGAATTTGGAAGAGGG - Intronic
908067219 1:60419850-60419872 TCTTTTAGGAAGAGAGAAGATGG + Intergenic
908117572 1:60954904-60954926 CATTTTCTGAATCGAAAAGCTGG + Intronic
908564722 1:65342448-65342470 CCTTCTACGAATAAAGAAGTGGG + Intronic
909780439 1:79539817-79539839 CACTTTATGTCTAGAGAAGCTGG + Intergenic
910060621 1:83087434-83087456 CTTTTTATGTACAGAAAAGCTGG + Intergenic
913225180 1:116692916-116692938 CCCTTTGTAAAAAGAGAAGCAGG - Intergenic
915802895 1:158813571-158813593 CCTATTGTGAATATAGAGGCTGG + Intergenic
915981788 1:160424918-160424940 CATTTTATAAATGAAGAAGCCGG - Intronic
916926770 1:169529681-169529703 CCTTTGATGAAAAGAAGAGCTGG - Exonic
917522789 1:175761802-175761824 CCTCTTCTGAGTATAGAAGCAGG - Intergenic
918885007 1:190181473-190181495 AATTTTATGCATAGAAAAGCAGG - Intronic
919388564 1:196953200-196953222 CCTTATATGAATAAAGCAGCTGG + Intronic
919391038 1:196986313-196986335 CCATATATGAATAAAGCAGCTGG + Intronic
921699131 1:218247277-218247299 ACTTTTATTAAAAGAGTAGCAGG + Intergenic
923985779 1:239380293-239380315 CCTTTTATGGATGGGGAAACTGG - Intergenic
1062941709 10:1426813-1426835 CCTTGTCTGAAGGGAGAAGCAGG - Intronic
1063726044 10:8638560-8638582 CAGCTTATGAACAGAGAAGCTGG + Intergenic
1064239330 10:13611396-13611418 CCTTTTATGAAAAGTCAAGAGGG - Intronic
1069211866 10:65771765-65771787 CTTTTTATGTTTAGAGAAGGGGG + Intergenic
1070488571 10:76954154-76954176 CCATTTAGGAAAAGAGGAGCGGG - Intronic
1072230018 10:93406824-93406846 TCTTTTCTGAATAAAGAAGTAGG + Intronic
1074617495 10:115084088-115084110 TCTTTTATGAATAAAGAAACAGG + Intergenic
1075824752 10:125345978-125346000 CCTTAAATAAATAGAAAAGCCGG + Intergenic
1079987433 11:27213730-27213752 ACTTTTATAAAGGGAGAAGCTGG - Intergenic
1080115528 11:28617577-28617599 CATTGTAGGAAGAGAGAAGCAGG - Intergenic
1080184103 11:29458736-29458758 ACTTTTTTGAGCAGAGAAGCAGG + Intergenic
1080961855 11:37169814-37169836 CCTTTTATGAACAAAGAAACTGG - Intergenic
1081633573 11:44705575-44705597 ACTGTGATGAAAAGAGAAGCGGG - Intergenic
1085210880 11:74777167-74777189 CATTTTATGAATGAAGAAACAGG + Intronic
1085954202 11:81371219-81371241 CATTTTTTAAATAGAGAAACCGG + Intergenic
1087706696 11:101501481-101501503 CCTTACAGGAATAGAGAAGTTGG - Intronic
1089438595 11:118494601-118494623 CCTCGTATTAACAGAGAAGCTGG + Intronic
1089855055 11:121536389-121536411 CCCTTGAGGTATAGAGAAGCAGG + Intronic
1090919368 11:131194535-131194557 CATTTTAACAAGAGAGAAGCGGG - Intergenic
1092174331 12:6392688-6392710 CCTTTTATGGAAGGAGCAGCCGG - Intergenic
1093868309 12:24255688-24255710 TCTTTAATGAATAGAGAGGTAGG + Intergenic
1095159049 12:38894026-38894048 AATTTTATGATTGGAGAAGCAGG - Intronic
1096282923 12:50272287-50272309 CCTTTCTTTAAAAGAGAAGCTGG + Intronic
1096835634 12:54349289-54349311 CCTTTTCTGACTAGGGAATCAGG + Intronic
1097462204 12:59875586-59875608 CCTTTTACTACTAAAGAAGCAGG + Intergenic
1097832239 12:64237721-64237743 CATTTTATAAATAAAGAAACTGG + Intergenic
1098496431 12:71141147-71141169 CCTTTTATAAATGGGGAAACTGG - Intronic
1098859072 12:75687604-75687626 CCTTTTCTGACAAGAGAAGGTGG - Intergenic
1099044647 12:77701092-77701114 TCTTTTAGAAACAGAGAAGCAGG - Intergenic
1099999582 12:89817128-89817150 ACTTTTCTGATTAGATAAGCTGG + Intergenic
1100332152 12:93593346-93593368 GCTTTTATGGTTAGAGAAGGAGG + Intergenic
1102659405 12:114512903-114512925 CCTTTTATGAAGGGGGAAGTAGG - Intergenic
1103198761 12:119069261-119069283 CTTTTTATAAATACAGATGCTGG + Intronic
1104199744 12:126577040-126577062 CCCTCTAGGAATTGAGAAGCAGG + Intergenic
1105506950 13:21018495-21018517 CCTTTGATGAAAGGACAAGCAGG + Intronic
1107050127 13:36038145-36038167 CATTTTATGAACAAGGAAGCTGG + Intronic
1107363716 13:39647372-39647394 CCATTTATGAACAAGGAAGCGGG + Intergenic
1108776726 13:53774076-53774098 TCTTGGATGAATAGAGTAGCAGG - Intergenic
1109005006 13:56862513-56862535 CCTTTAATGAGTAGAGTATCAGG - Intergenic
1109007941 13:56902148-56902170 CCTTTTCTAAATAGAGATGTTGG + Intergenic
1109202511 13:59446514-59446536 CCTTTATTAAATATAGAAGCAGG - Intergenic
1110517702 13:76435657-76435679 CTTTTTATGAACAGAGAAATAGG - Intergenic
1112119112 13:96390446-96390468 CTTTTTATGAATGAGGAAGCAGG + Intronic
1112384271 13:98923480-98923502 CTTTGTCTGAATAAAGAAGCTGG - Intronic
1112703382 13:102037646-102037668 CGTTTGATGAACAGAGAACCAGG - Intronic
1117920082 14:60720522-60720544 CCTTTAATGGATTTAGAAGCTGG - Intronic
1118597734 14:67449074-67449096 CCTTTTAGGAAGGGAGAAGCTGG + Intronic
1119044181 14:71302937-71302959 CATTTTAAGAATAAAGAAACTGG - Intergenic
1123739493 15:23222805-23222827 CATTTTATGAACAGAAAACCCGG - Intergenic
1124290712 15:28451765-28451787 CATTTTATGAACAGAAAACCCGG - Intergenic
1124292524 15:28465793-28465815 CATTTTATGAACAGAAAACCCGG + Intergenic
1124828208 15:33121194-33121216 CCTTTTATCAATAGAGCAGTGGG + Intronic
1124918875 15:34004986-34005008 GCTTTTATTAACACAGAAGCAGG + Intronic
1125315285 15:38424995-38425017 TCTTTTATGAATAGGGAAATAGG + Intergenic
1126696834 15:51333455-51333477 CCTCTTATGATTACAGAATCGGG + Intronic
1129589625 15:76904251-76904273 TATTTTATGAATGGAGAAACGGG - Intronic
1129811129 15:78510977-78510999 TTTTTTTTAAATAGAGAAGCGGG + Intronic
1131922718 15:97347543-97347565 CATTTTAGGAATAAAGAAACTGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1137383860 16:48023523-48023545 CCTTTAATGAATATAGAAGGTGG + Intergenic
1142299828 16:89250142-89250164 CATTTTATGAATATTGAAACTGG + Intergenic
1142640451 17:1282667-1282689 CCTTTAAAGAATATAGAAACAGG - Intronic
1147876755 17:43627236-43627258 CATTTTATGAATAAAGAAACTGG + Intergenic
1148959354 17:51380169-51380191 CCTTTTGTGAACAGAGTAGCTGG - Intergenic
1151193814 17:72417790-72417812 CTTTCTATGAATAAAGATGCAGG + Intergenic
1151404142 17:73875982-73876004 CCTTGAATGGATAGAGAGGCAGG - Intergenic
1151919661 17:77144467-77144489 CCTTCTATAAATAGAAACGCAGG + Intronic
1155930890 18:31707059-31707081 CCTCTTATGAAGAGAGAAAAAGG - Intergenic
1157395919 18:47340852-47340874 CTTCTTATGAATGAAGAAGCAGG + Intergenic
1158729274 18:60004291-60004313 CCAGTTCTGAAGAGAGAAGCTGG + Intergenic
1160546182 18:79657471-79657493 CCTTTTGTGGACAGAGCAGCAGG - Intergenic
1163922471 19:20304300-20304322 ATTTTTATGTATAGAGAAGTTGG - Intergenic
1164309421 19:24033281-24033303 CGTTTTATGAACAGAAAAACAGG - Intergenic
1164852041 19:31492104-31492126 CCTTCTATGAACCAAGAAGCGGG - Intergenic
1168154428 19:54465043-54465065 CCGTTTATGTATACAGAAGTGGG + Exonic
1168399773 19:56078811-56078833 ATTTTTTTAAATAGAGAAGCTGG - Intergenic
926047100 2:9717816-9717838 CCTTTGATGAATGGAGAAGGTGG + Intergenic
927095020 2:19741599-19741621 GCTTTTATGAATAATGATGCTGG - Intergenic
928061635 2:28119303-28119325 ACTTTTATGAGTAGAGAAGTTGG + Intronic
928309756 2:30199591-30199613 CCATTTATGAACTAAGAAGCAGG + Intergenic
928494064 2:31813677-31813699 CCTTTTATGAGTACAGAATGGGG + Intergenic
928893991 2:36240163-36240185 CCTTTTATAAATTCAGAGGCAGG - Intergenic
930270485 2:49250799-49250821 CGGTTTATGAAGAGAGAAGAAGG + Intergenic
932579921 2:72986423-72986445 CCTTTTACAGATGGAGAAGCAGG + Intronic
935575496 2:104705550-104705572 CCTTTAATGAATATATAAGTCGG + Intergenic
935872207 2:107463421-107463443 CCTTGTAAGAAAACAGAAGCAGG + Intergenic
936656407 2:114493219-114493241 CCTTATAGGAATAGTGGAGCCGG - Intronic
936988423 2:118334682-118334704 CCTATAATGAATAGAGTAGCTGG + Intergenic
937775919 2:125775577-125775599 CCTTCTACAAATAGAGAACCAGG + Intergenic
937814090 2:126231779-126231801 ACTTTTATAAATAAAGAAGGAGG - Intergenic
939158258 2:138552130-138552152 CCATTTTTGAAGGGAGAAGCAGG + Intronic
939515988 2:143168982-143169004 GCCTTAATGGATAGAGAAGCAGG + Intronic
939662463 2:144907094-144907116 CCTTTTATGAAAAATAAAGCAGG + Intergenic
939713509 2:145554163-145554185 CTATTTATAAATAGAGAATCTGG + Intergenic
943447898 2:188012180-188012202 CCTTTAGTGAATTGAGAAGATGG + Intergenic
944330468 2:198459708-198459730 GTTGTTATGAATAGAGAAGATGG - Intronic
944593680 2:201242389-201242411 CCATTTATGAACCAAGAAGCAGG - Intronic
944916554 2:204366652-204366674 CGCTTCATGAATTGAGAAGCTGG - Intergenic
945506538 2:210648362-210648384 CCTTTAGAGAATAAAGAAGCTGG + Intronic
946057523 2:216915012-216915034 CGTTGGATGAAAAGAGAAGCAGG - Intergenic
1170699319 20:18689129-18689151 CGTTTTCGGAATAAAGAAGCTGG + Intronic
1172002123 20:31787439-31787461 CCCTTTCTGAAAAGTGAAGCGGG - Intronic
1172895842 20:38299462-38299484 CCTTTTATGAGACGTGAAGCTGG + Intronic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1175037580 20:56014926-56014948 CCTCTTATGGCAAGAGAAGCTGG - Intergenic
1175673050 20:60922364-60922386 CCTTTCTTGATTAGAGAAGCAGG + Intergenic
1178292500 21:31380936-31380958 CATTTTACCTATAGAGAAGCTGG - Intronic
1180090733 21:45532733-45532755 TCTATTAAAAATAGAGAAGCTGG - Intronic
1181998252 22:26900219-26900241 ACTTTTCTTAATAGAGAAACTGG + Intergenic
955003740 3:54950672-54950694 CCTTTCGTGAGTAGAGAACCTGG - Intronic
955403209 3:58608554-58608576 CATTTTACAGATAGAGAAGCTGG + Intronic
956759652 3:72429105-72429127 CCTGTTATGAACAGAAAAGCAGG + Intronic
957037029 3:75302907-75302929 CCTTATATGTGGAGAGAAGCAGG - Intergenic
958194063 3:90220147-90220169 TCTTTTATGCCTAGAGGAGCTGG - Intergenic
958417420 3:93891177-93891199 TCTTTTATGCCTAGAGGAGCTGG - Intronic
958658589 3:97036044-97036066 CCATTTATGAACAAGGAAGCAGG + Intronic
958732396 3:97972869-97972891 CCTTTTATGAATAGAGAAGCAGG + Intergenic
959320127 3:104862883-104862905 TTTTTTATAAATAAAGAAGCTGG - Intergenic
959406177 3:105963952-105963974 TCTTTTATGGATAAAGAAACTGG + Intergenic
961196674 3:125007813-125007835 CAGTTTAAGAATAGAGAAGCTGG - Intronic
962949642 3:140205951-140205973 CTTTTTGGGAATAGAGAAGATGG - Intronic
966107087 3:176349090-176349112 TTTTGTATGAATAGAGAAACTGG + Intergenic
967510370 3:190304220-190304242 CATTTTATGAATGAAGAAACTGG + Intergenic
968237470 3:197043255-197043277 CCTTTTATTAATAGGAAGGCAGG - Exonic
969195204 4:5556627-5556649 CATTTTATGAAACCAGAAGCTGG + Intronic
970234367 4:13944087-13944109 CCTTTAAATAATACAGAAGCGGG + Intergenic
970325336 4:14917985-14918007 CATTTTATGAATAGAGTCTCAGG - Intergenic
970374998 4:15448064-15448086 CCATCTATGAATGGGGAAGCAGG + Intergenic
970695885 4:18676560-18676582 GCTATTTTGAATATAGAAGCAGG - Intergenic
974479412 4:62423926-62423948 CCTTTCATGAGTAGTGAATCAGG + Intergenic
975389307 4:73798065-73798087 CATTTTATGAATAAACCAGCTGG + Intergenic
978200102 4:106015926-106015948 CATTTTATGGATAGGGAAACTGG + Intergenic
978481175 4:109192551-109192573 CCTTTTAAGAAAAGAGAAGGTGG + Intronic
979266888 4:118714122-118714144 CTCTATATTAATAGAGAAGCAGG + Exonic
980227508 4:130005614-130005636 TATTTTATTAATAGGGAAGCAGG - Intergenic
981279503 4:142941002-142941024 CTCTTTTTGAAGAGAGAAGCAGG + Intergenic
983441201 4:167788134-167788156 CATTTAAGCAATAGAGAAGCAGG + Intergenic
983740781 4:171130226-171130248 ACGTTAATGAAAAGAGAAGCAGG - Intergenic
984666082 4:182431187-182431209 GCTTTCATGAATAGAAAAGGAGG + Intronic
985368027 4:189254265-189254287 CATTTTATGAATAGCAAAGTGGG - Intergenic
985806928 5:2052720-2052742 CCTCATCTGAATAGAGAAGATGG - Intergenic
986578474 5:9236938-9236960 TCTTTTATAAATACAGAAGGGGG + Intronic
987563031 5:19549045-19549067 CCTTTTAAAAACAAAGAAGCTGG - Intronic
987594865 5:19984712-19984734 CCTTTTATGGATAAAGAAAATGG + Intronic
988094224 5:26582314-26582336 CATTATATGAAGAGAGAATCTGG + Intergenic
988225472 5:28406704-28406726 CCTTTTCTGAACAGGGGAGCGGG + Intergenic
988548757 5:32181574-32181596 CATTTTATGAAAAGAGAAACAGG + Intergenic
990853171 5:60230596-60230618 ACTTTTAGGAAAGGAGAAGCTGG + Intronic
994385525 5:99126626-99126648 CATTTTATGAATAGCAAAGTTGG - Intergenic
994855171 5:105111220-105111242 CCTTTTATGAATGCAGATTCTGG - Intergenic
995159413 5:108960821-108960843 CAATTTATGACTTGAGAAGCTGG - Intronic
996097807 5:119417369-119417391 CCTTTTAAATATAGGGAAGCCGG - Intergenic
996194770 5:120590696-120590718 CATTTTATAATTATAGAAGCTGG - Intronic
998796264 5:145822675-145822697 CATTTAATGAATGGAGAAACTGG - Intronic
999139965 5:149353910-149353932 CATTTTACGAATAAAGAAACAGG - Exonic
999984566 5:156990936-156990958 CCTTTGATGAAAGGAGAAGTGGG + Intergenic
1001907790 5:175487414-175487436 CCATTTCTGGATAGTGAAGCGGG - Intronic
1004010159 6:11677397-11677419 CCAATAAAGAATAGAGAAGCGGG + Intergenic
1004669783 6:17784885-17784907 CCCTTTATCATTAGAGATGCAGG + Intronic
1004829410 6:19461450-19461472 CTTTTCATGAATAGACATGCTGG + Intergenic
1005360704 6:25028313-25028335 CATTTTCTGAATAGAGAGGGTGG + Intronic
1008422008 6:51311998-51312020 TTTTTGTTGAATAGAGAAGCAGG - Intergenic
1012013576 6:93825191-93825213 ACTCTTATGAAAAGAGAAACAGG - Intergenic
1012083923 6:94798581-94798603 AATTTTATGAATTGAGAGGCTGG + Intergenic
1013386610 6:109638084-109638106 CCTTTTATGAAAAAGGAGGCAGG + Intronic
1015363853 6:132375208-132375230 GCTTTTATGAATGGTGAAGTGGG - Intronic
1016357433 6:143233424-143233446 CCTTTTAACAATACATAAGCAGG - Intronic
1016716602 6:147239533-147239555 CCTTTTATGCAAAAAAAAGCAGG - Intronic
1019052453 6:169193471-169193493 GCTTCTATGCAAAGAGAAGCAGG + Intergenic
1020894231 7:13919197-13919219 CCTTTTATAAATGAAGAAACTGG + Intronic
1020972521 7:14963537-14963559 CCTTTTATGAATAATTAATCAGG + Intronic
1022197009 7:28078655-28078677 CCATTTATGAACAGTGAATCCGG + Intronic
1022499644 7:30874427-30874449 CCTCTTAGGAATGGAGAAACTGG - Intronic
1024542241 7:50486183-50486205 CTTCTTATGGATATAGAAGCTGG - Intronic
1024932033 7:54674123-54674145 CTTTTTTTGTAAAGAGAAGCTGG + Intergenic
1025110590 7:56212932-56212954 CCATTTATGCATAGGGAAACTGG - Intergenic
1027641586 7:80740219-80740241 TCATTTATAAGTAGAGAAGCTGG + Intergenic
1028419479 7:90616460-90616482 CCTTTTAAGAGAAGAGAATCAGG - Intronic
1031546525 7:123057029-123057051 CCTTTTATGACAATAGAAGAGGG + Intergenic
1031693892 7:124825088-124825110 CCTTTGATGAAGAGAGTGGCAGG - Intronic
1031772701 7:125864963-125864985 ACTATTATAAATAGAGAATCAGG + Intergenic
1032851610 7:135800007-135800029 CCTTTTATAAATAAGGAAACTGG - Intergenic
1033534906 7:142303275-142303297 CCTTTAATAAATATAGAAACTGG - Intergenic
1033779961 7:144657232-144657254 GTTTTTATGAATGGAGAAGTGGG + Intronic
1034059157 7:148070004-148070026 CAGTTTATGGATAAAGAAGCAGG + Intronic
1037297628 8:17417744-17417766 CCGTCTATGAATCCAGAAGCAGG + Intergenic
1037692917 8:21197834-21197856 CCTTTTAGGAAGAGAGAATTTGG + Intergenic
1037725187 8:21477537-21477559 CATTTTATAAATAGGGAAACTGG + Intergenic
1038424948 8:27458915-27458937 CCCTTGATGCACAGAGAAGCTGG + Exonic
1039570826 8:38585229-38585251 CCTTTTAGTAAAGGAGAAGCAGG + Intergenic
1041532288 8:58882683-58882705 CCTTTTAACAATAGACAAACTGG + Intronic
1041895936 8:62924820-62924842 TCATTTATGAAGAGAGAAGTGGG - Intronic
1042170928 8:65990085-65990107 CCTTTCATAAATAAAGAAGATGG - Intergenic
1045988997 8:108284108-108284130 CCTGTTATGAATGAACAAGCTGG - Intronic
1046979112 8:120317227-120317249 CCTTGTTTGAGTAGAGAAGTGGG - Intronic
1047298111 8:123588992-123589014 CGTGTTATGAATAAAGAAACTGG - Intergenic
1048857230 8:138695506-138695528 CCCTTTCTAGATAGAGAAGCTGG + Intronic
1050058629 9:1681332-1681354 CATTTTATCAATAAAGAACCAGG - Intergenic
1050681040 9:8111784-8111806 CCTTTTCTGAATTGAGAAGTGGG - Intergenic
1051293107 9:15565509-15565531 CTTTTTATAATTAGAGAATCTGG + Intronic
1051895241 9:21979713-21979735 CCTCTTATGAGTAGAGAGGATGG + Intronic
1051980004 9:23002260-23002282 CCTTTTTTGAATCGAGATGAAGG + Intergenic
1051988253 9:23118050-23118072 CCTTTTCTAAATAAAGAATCTGG + Intergenic
1052184045 9:25567885-25567907 CATTTTATCAATAGACAAACAGG + Intergenic
1052479274 9:29001927-29001949 CCAGTGATGAAGAGAGAAGCAGG - Intergenic
1052602858 9:30659847-30659869 TCTTTTATAAATAGATGAGCAGG - Intergenic
1052709472 9:32035769-32035791 CAGAGTATGAATAGAGAAGCAGG + Intergenic
1052926872 9:34024494-34024516 CTTTTTATGAATAGGGAATTAGG - Intronic
1059632966 9:116144382-116144404 ACTTTTATGGGTAGAAAAGCAGG - Intergenic
1059840921 9:118214923-118214945 TCTCTTATAAATACAGAAGCAGG - Intergenic
1059972258 9:119679820-119679842 CATTTTATAAATAAAGAAACTGG - Intergenic
1060194160 9:121612431-121612453 GCTTTGATGAATAGAGAAAGGGG + Intronic
1061035288 9:128110242-128110264 CCTCCAATGAATAGATAAGCTGG + Intergenic
1061888451 9:133605246-133605268 CATTTTATGAATGAAGAACCTGG + Intergenic
1185528763 X:800479-800501 CCGTCTATGAAATGAGAAGCTGG - Intergenic
1186449586 X:9660993-9661015 CCATCTATGAATCGGGAAGCGGG + Intronic
1188840987 X:35017092-35017114 TCTTTCATGAAAAGAAAAGCTGG + Intergenic
1189577075 X:42365340-42365362 CATTTTTTTAAGAGAGAAGCTGG + Intergenic
1191242681 X:58201784-58201806 CATTTTAAGAATAGAGAACCTGG + Intergenic
1192100005 X:68254423-68254445 CCTTTTGAGAATAGAGATGCTGG - Intronic
1193037251 X:76965569-76965591 TCTTTTATGAATAAAGACACAGG - Intergenic
1193929700 X:87537849-87537871 CATTTTAAGAATTGAGAAGAAGG + Intronic
1194054210 X:89110469-89110491 CCTTTAAATAATACAGAAGCGGG - Intergenic
1194475142 X:94348992-94349014 CCTTCTATTAGTAGAAAAGCAGG + Intergenic
1194541792 X:95182175-95182197 TTTTTTATGAATAAAGAGGCTGG + Intergenic
1195449686 X:104997354-104997376 CTTTTAAAGTATAGAGAAGCAGG - Intronic
1196039589 X:111187909-111187931 CATTTTATGACAAGAGAACCAGG + Intronic
1196251091 X:113460778-113460800 CCATCTATGAATAAAGAAGAGGG - Intergenic
1201721552 Y:17103907-17103929 CCTTTTAAGAACAGATATGCTGG - Intergenic