ID: 958735650

View in Genome Browser
Species Human (GRCh38)
Location 3:98006769-98006791
Sequence TGGAGGGTGAGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2818
Summary {0: 1, 1: 1, 2: 28, 3: 361, 4: 2427}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958735636_958735650 21 Left 958735636 3:98006725-98006747 CCTAAAATAACCCAGAATATTAA 0: 1
1: 0
2: 4
3: 42
4: 540
Right 958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG 0: 1
1: 1
2: 28
3: 361
4: 2427
958735643_958735650 -5 Left 958735643 3:98006751-98006773 CCAGAAGGGGAATGATAGTGGAG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG 0: 1
1: 1
2: 28
3: 361
4: 2427
958735637_958735650 11 Left 958735637 3:98006735-98006757 CCCAGAATATTAATATCCAGAAG 0: 1
1: 0
2: 2
3: 23
4: 261
Right 958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG 0: 1
1: 1
2: 28
3: 361
4: 2427
958735638_958735650 10 Left 958735638 3:98006736-98006758 CCAGAATATTAATATCCAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 162
Right 958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG 0: 1
1: 1
2: 28
3: 361
4: 2427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958735650 Original CRISPR TGGAGGGTGAGGAGGGCAGA GGG Intronic
Too many off-targets to display for this crispr