ID: 958735755

View in Genome Browser
Species Human (GRCh38)
Location 3:98007628-98007650
Sequence CTGTAAAAGGAGAGGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 568}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958735755 Original CRISPR CTGTAAAAGGAGAGGAATGA TGG Intronic
900040839 1:463033-463055 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
900062269 1:698009-698031 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
900645860 1:3708499-3708521 CTGTAAAAGGGGAGCAGTGATGG - Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
902185706 1:14723650-14723672 GTGGAAAAGGAGACGAATGCAGG - Intronic
902916212 1:19641190-19641212 CTGTAAAATGGGAACAATGATGG + Intronic
903303933 1:22399458-22399480 CTGTAAAATGAGAAGAATAATGG - Intergenic
903318000 1:22524148-22524170 GGGTAAAATGAGAGAAATGAGGG - Intronic
903356204 1:22749365-22749387 CTGGAAAAAAAGAGGAATGCAGG + Intronic
903725781 1:25443144-25443166 ATATGAAAGGAGAGGAATTAGGG + Intronic
903872308 1:26445136-26445158 CTGTAAAAGGGGAATAATAAGGG + Intronic
904351868 1:29913680-29913702 CTGGAAAAGGTGAGCAATGAGGG + Intergenic
904385171 1:30136448-30136470 CTGGAAAAGGCGAGCAATGAGGG - Intergenic
904736345 1:32637111-32637133 TTTTAAAGGGAGAGGAGTGAGGG - Intronic
905745592 1:40414726-40414748 CTGAAAAATGAAAGGAATGGGGG - Intronic
905822376 1:41003616-41003638 CTGTAAAATGGGAGTAATAAAGG + Intronic
906484254 1:46222123-46222145 CTGGAAAAGGAGAGGGAGCAAGG + Intergenic
907297689 1:53465848-53465870 GTGTAAAAGGAGACTAATAATGG + Intronic
907332927 1:53683105-53683127 CTTTAGAAGGAAAGGAAAGAAGG + Intronic
907830980 1:58064061-58064083 CTGTAACAGTTGAGGAATAAAGG - Intronic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
908066743 1:60414394-60414416 CTTTGAAAGGACAAGAATGATGG - Intergenic
908668259 1:66516479-66516501 CAGTAAAAAGAAAGAAATGAAGG + Intergenic
908713216 1:67041320-67041342 CTTTAAAAGAAGAGGTATGATGG + Intronic
908933805 1:69348878-69348900 CAGTGAAAGGAGAGGAAAAATGG + Intergenic
910122760 1:83808682-83808704 CTGGCTAAGGAGAGGAGTGAGGG + Intergenic
910421774 1:87071956-87071978 CAAGAAAAGGAGAGGAAAGAAGG - Intronic
910447046 1:87309482-87309504 GAGTAAAGGGAGAGGAATGCCGG - Intergenic
910609118 1:89121271-89121293 CTGTAGAAGGAGAGGATAAAAGG + Intronic
911431887 1:97800100-97800122 CTGTAAAATTAGAGTAATAATGG + Intronic
912577812 1:110691035-110691057 CTGTAACAGGAGATGAAACATGG + Intergenic
913154402 1:116080739-116080761 AAGTAAAAGGAAAGGAAGGAGGG - Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914258181 1:145977376-145977398 GTTTTAAAGGAGAGGAAGGAAGG - Intronic
914384890 1:147158994-147159016 ATGTGAAATGAGAGGAATAAGGG + Exonic
914429744 1:147610601-147610623 CTGACAAAGTATAGGAATGAAGG - Intronic
915262342 1:154686122-154686144 CTGCAAAAGGGGAATAATGATGG - Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916783478 1:168062235-168062257 CTTTAAAGGGACAGTAATGATGG + Intronic
917427239 1:174927528-174927550 CTTTAAAAAGAGAGGAAATATGG - Intronic
917452403 1:175157967-175157989 GTGAAAATGGAGAGGAATAAAGG + Intronic
917485226 1:175449418-175449440 AAGGAAAGGGAGAGGAATGATGG - Intronic
918248125 1:182678669-182678691 CTGGACAAGGAGAGAAATGATGG + Intronic
918677383 1:187304422-187304444 CTCAAAAAGGAGAGGAAATATGG + Intergenic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
919976860 1:202618492-202618514 CTGCAAGAGGAGAGGAAGGGTGG - Intronic
920213144 1:204343390-204343412 CTGTAAAATGTGAGTGATGATGG - Intronic
920726026 1:208435990-208436012 CTGTCAAAGAAGAGAACTGATGG + Intergenic
920819027 1:209363091-209363113 CAGAAAGAGGAAAGGAATGAGGG - Intergenic
921151021 1:212403327-212403349 CTGGAAAAGGAGTTGAATGGAGG - Intronic
921676417 1:217981570-217981592 CTGTAAAATGAGAAGACTAATGG - Intergenic
921936874 1:220803767-220803789 GTATAAAAGGAGAGAAATAAGGG - Intronic
922161384 1:223081245-223081267 TTCTAGAAGGGGAGGAATGAGGG + Intergenic
922545820 1:226456078-226456100 CTGTTGGAGGTGAGGAATGAGGG - Intergenic
922910779 1:229214973-229214995 CTGAAAAAGAAGAGTAATAATGG + Intergenic
922987198 1:229874954-229874976 CTGTAAAGGGAGAGGAAAAATGG + Intergenic
923368607 1:233287839-233287861 CTGTAAAATGGGAATAATGATGG + Intronic
923411008 1:233709051-233709073 CAGGAAAAGGAGAGGAATGGAGG - Intergenic
923806107 1:237259751-237259773 CCGTAAAATGTGAGGACTGAAGG + Intronic
924554762 1:245108871-245108893 TTCTAAAAGCAGAGGAATAATGG - Intronic
1063268408 10:4479493-4479515 CTGAAAAGGGAGATGGATGAGGG + Intergenic
1063380416 10:5582038-5582060 CTGTATACCGAGAGGAATGCAGG - Intergenic
1063537379 10:6897321-6897343 TTGAAAAAGGAGAGTAATGTTGG + Intergenic
1064807129 10:19147973-19147995 ATGAAACAGGAGAGGAAGGAAGG + Intronic
1065451839 10:25867214-25867236 CTGTAAAATGGGAGTAATAATGG - Intergenic
1065672196 10:28132377-28132399 CAGTAAGAGGAGAGGATTCAAGG - Intronic
1066477062 10:35757739-35757761 CTGCACAAGGGGAGAAATGAAGG - Intergenic
1068059638 10:52051191-52051213 TTTTAAAAGGAGATGGATGAGGG + Intronic
1068787533 10:60992394-60992416 CATTACAAGGGGAGGAATGAAGG + Intronic
1069102668 10:64342419-64342441 CTGGAGAAGGAGAGGTATTATGG - Intergenic
1069190364 10:65479904-65479926 CAGAAAAAGGATAGGAAAGAAGG + Intergenic
1070079180 10:73168456-73168478 CTGGGAAAGGAAAGGAACGAAGG - Intronic
1070274075 10:74987640-74987662 CTGTAAACAGAAAGGAAAGAAGG + Intronic
1070339809 10:75487593-75487615 CTGTAAGAGAATAGGAAGGAGGG - Intronic
1071027095 10:81128002-81128024 CAGAAAAAGGAAAGGAAAGATGG - Intergenic
1072709124 10:97704236-97704258 CTCTAAAAAGAAAGGAAGGAAGG + Intergenic
1073545749 10:104347371-104347393 CTGGAAAAGGAGAAGATTAAAGG + Intergenic
1073661606 10:105482021-105482043 AAGTAAAAGGAAAGAAATGATGG + Intergenic
1073776598 10:106793301-106793323 ATGCAAAAGCAGAGGAATGCGGG + Intronic
1074094720 10:110301242-110301264 AGGAAAAAGGAGGGGAATGAGGG + Intronic
1074134919 10:110617980-110618002 CTGAAGAAGGACAGGAATGAGGG - Intergenic
1074769311 10:116723214-116723236 TTGTATGAGGACAGGAATGATGG - Intronic
1074977414 10:118592690-118592712 CCCTAAAAGGAAAGGAAAGAGGG - Exonic
1075480354 10:122775817-122775839 CTGTAAAAGGGGAAGAACCATGG - Intergenic
1075642057 10:124072002-124072024 CTGGGTAAGGAGAGGAATGGAGG - Intronic
1076967112 11:99262-99284 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
1077718765 11:4606709-4606731 CTGTAAAATGAGAACAATAATGG - Intronic
1078463404 11:11532322-11532344 TTGTAAAAAGAGATGAACGATGG - Intronic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1079078238 11:17396735-17396757 CAATAGAAGGAGAGGAAAGATGG + Intronic
1079264679 11:18919891-18919913 CTGTGGATGGAGAGGAATGGGGG + Intergenic
1079425472 11:20337948-20337970 CTGTTAAGAGAGAGCAATGAAGG - Intergenic
1080694555 11:34590373-34590395 CTGTAACAAGAAGGGAATGATGG - Intergenic
1081238203 11:40671625-40671647 CTGAATAAGGACAAGAATGAAGG - Intronic
1081351014 11:42052200-42052222 TTGTAAGAGGAAAGGAAGGAGGG - Intergenic
1082758812 11:57106197-57106219 CTGTAAAAAGGGAGGAAAGGGGG + Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1084680440 11:70663404-70663426 CTGTAAAATGGGAGGATCGAGGG - Intronic
1084702584 11:70796944-70796966 CCGTAAAAGGACAGAAAGGAAGG + Intronic
1085560860 11:77472421-77472443 CTGTAAGAGGAGAGACAGGATGG + Intronic
1085817721 11:79758377-79758399 CTGTAAAATGAGAACAATAATGG - Intergenic
1086920512 11:92581201-92581223 CCTTAAAGGGAGAGGAATTATGG + Intronic
1087655758 11:100921022-100921044 CTGAAAAAGTAGAGGCACGAAGG - Intronic
1088009584 11:104983918-104983940 CTGTAAAATGGGAGAAATAAAGG - Intergenic
1088442304 11:109884932-109884954 CTGGAGTAAGAGAGGAATGAGGG - Intergenic
1088482941 11:110312957-110312979 CTTTAAATGGAGAGGAAAAATGG + Intergenic
1088813033 11:113404364-113404386 CTGGAAGAGGAGAGAAGTGATGG - Intergenic
1089254048 11:117184702-117184724 CTGTGATAGGAGGGGAAAGAAGG + Intronic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1089719756 11:120404560-120404582 ATGAAAAAGGAGAGGAAAAATGG - Intronic
1090461997 11:126899431-126899453 CTGACAAAGGAAAGGAAGGAGGG + Intronic
1090833793 11:130439140-130439162 GTGGAAAAGGAGAGAAATGGAGG - Intergenic
1091131243 11:133148851-133148873 CTGAAAAAGGGAAGGAAGGAAGG + Intronic
1091718646 12:2796391-2796413 AGGTAAAAGGGAAGGAATGATGG - Intronic
1092448031 12:8575773-8575795 CTGTAACAGAAGACCAATGATGG - Intergenic
1092520318 12:9265951-9265973 GTGGAAAACCAGAGGAATGAGGG - Intergenic
1093151345 12:15625441-15625463 CTGTAAAAGGAGCAGAAAAATGG - Intronic
1094352172 12:29539409-29539431 TAATAAAAGGAGAAGAATGAGGG - Intronic
1094753740 12:33442043-33442065 TAGTAAAAGGAGAGGAGTGCAGG + Intergenic
1095864403 12:46955856-46955878 CTGGAAAAGGAGAGGATTTCGGG - Intergenic
1096117725 12:49065193-49065215 CTATAAGAGGAGAGGATTCAGGG + Intronic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096656664 12:53096744-53096766 CTGGGAGAGGAGAGGAATGGAGG + Intergenic
1096670713 12:53196821-53196843 CTGGGAGAGGAGAGGAATGAAGG + Intronic
1097232018 12:57518609-57518631 GTGTGAGAGAAGAGGAATGAAGG - Intronic
1097313127 12:58143037-58143059 CTGTAAAATGAGGATAATGATGG - Intergenic
1097864454 12:64547946-64547968 CTGAAAAAAGAGAGGAATGAAGG - Intergenic
1098216073 12:68221300-68221322 GAGGAAAAGGAAAGGAATGAAGG + Intronic
1098406275 12:70129838-70129860 CTGGGAAATGATAGGAATGAAGG - Intergenic
1099972650 12:89515859-89515881 TTGAATAAGGAGAGAAATGAAGG - Intronic
1100006624 12:89902362-89902384 CTATAAAAGCAATGGAATGATGG - Intergenic
1100071421 12:90724188-90724210 CTGTATCTGGAGATGAATGAAGG - Intergenic
1100730522 12:97462438-97462460 ATTTAAAAAGAGAGGAATAAGGG - Intergenic
1102755198 12:115334170-115334192 CTGGAGAAGGAGAGGAAGCAAGG + Intergenic
1102794470 12:115676461-115676483 CTGGAAAAGGCAAGGAAGGAAGG - Intergenic
1103167851 12:118785639-118785661 CTCTAAAAGCAGGGTAATGAAGG - Intergenic
1103451847 12:121034714-121034736 CTGTAAAATGAAAGTAATGTTGG + Intronic
1105324551 13:19358427-19358449 CTGGAAAAGAAGCGTAATGAGGG + Intergenic
1105538650 13:21294380-21294402 TTGCAAAAAGAGAGGGATGAAGG - Intergenic
1107837599 13:44424084-44424106 CAGGAAGAGGAGAGGAATGTCGG - Intergenic
1108044607 13:46371898-46371920 GTGTGAACAGAGAGGAATGAGGG + Intronic
1108206857 13:48098765-48098787 CTGTAACAGGAGATGAAAAATGG - Intergenic
1108367291 13:49728560-49728582 TTGTAAAAGGAGATGAAACATGG + Intronic
1109109785 13:58302220-58302242 CTAGAAAAGTAGGGGAATGAGGG - Intergenic
1109233951 13:59792784-59792806 CTGAAAAAGTAGGAGAATGAAGG - Intronic
1109393186 13:61720067-61720089 ATATAAAAGGAAAGAAATGAAGG - Intergenic
1109971753 13:69779439-69779461 CAGTAAAAGGAAAGGAAAGAAGG - Intronic
1110601262 13:77377184-77377206 CTGTTCCAGGATAGGAATGAAGG - Intergenic
1110709055 13:78629846-78629868 CTATAAAAATAGAGGGATGATGG + Intronic
1110833322 13:80056521-80056543 CTGTAAAGGGAGAAAATTGATGG + Intergenic
1111492687 13:89003295-89003317 CTATAAAAGGAGAGAAATCATGG + Intergenic
1112095275 13:96126161-96126183 GTGGAAAAGGAGAGGACTAAGGG - Intronic
1112482682 13:99791605-99791627 CTGTAAAATAAGAGTAAGGATGG + Intronic
1112660560 13:101502923-101502945 CTGTAGATGGAGAGGCATAATGG - Intronic
1112992246 13:105528043-105528065 CCCTAAAAGGAAAAGAATGAAGG + Intergenic
1113432476 13:110262613-110262635 CTGTACAAGAAGAGGAAGCATGG + Intronic
1113508901 13:110836137-110836159 CCTTAAAAAGAGAGGAAAGAAGG + Intergenic
1113755015 13:112804462-112804484 CAGGAAAAGGAGGGGAAGGAGGG - Intronic
1114029051 14:18559343-18559365 CAGTAAGAGGAGAGGAATCAAGG + Intergenic
1114979691 14:28147479-28147501 TGATAAATGGAGAGGAATGAAGG - Intergenic
1115112308 14:29839338-29839360 TTGTAATAGGAGATGAATCATGG + Intronic
1115694027 14:35877249-35877271 TTCTAAAAGGAGTAGAATGATGG - Intronic
1116961209 14:50970101-50970123 CTGTAAAAGGAGAACAACTAAGG - Intergenic
1117481092 14:56145520-56145542 TTGTAGAAGGAGTGGAAAGAAGG - Intronic
1117959852 14:61152062-61152084 CTGTGAAAGGACAGGAGGGAAGG + Intergenic
1118667026 14:68081448-68081470 ATTTAAAAGGAGAAGAGTGAGGG + Intronic
1118817894 14:69325570-69325592 GTGTCAAAGGAGGGGAAAGAAGG + Intronic
1119231073 14:72980287-72980309 CTGTAAAAGGAGAAGTGTGCAGG + Intronic
1119544606 14:75462486-75462508 CTGTAGAAAGAGACTAATGAAGG - Intronic
1120192101 14:81448878-81448900 CTGTAAAATGAGAGTAATACCGG + Intergenic
1120930972 14:89848078-89848100 CAATAAAAGGAGAAGCATGAGGG - Intronic
1121978166 14:98425691-98425713 CTGTTGCAGGAGAAGAATGAAGG - Intergenic
1122150395 14:99722419-99722441 CTGTAAAACGTGAGGAGAGAAGG - Intronic
1122468713 14:101951392-101951414 CTCTGAAAGGGAAGGAATGATGG + Intergenic
1124492511 15:30166873-30166895 CTGCAAGAGGAGAGGAAGGGTGG - Intergenic
1124751024 15:32371452-32371474 CTGCAAGAGGAGAGGAAGGGTGG + Intergenic
1126314582 15:47356628-47356650 CTGTGAAATGAGAGGGATGAAGG - Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1127788648 15:62378748-62378770 GTGGGAAAGGAGAGGAAAGAAGG + Intergenic
1127899576 15:63331001-63331023 CTGTTAAGGAAGAGGAATGCCGG + Intronic
1128060671 15:64733689-64733711 CTGTAAAATTAGATGATTGATGG + Intergenic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1130329991 15:82914620-82914642 CTGGAAATGGAGAGTAGTGATGG + Intronic
1130407375 15:83613866-83613888 TTGGAAAAGGAGAGGACTCATGG + Intronic
1130575805 15:85092376-85092398 CTCTAGAAAGAGAGGTATGAAGG + Intronic
1131051493 15:89351225-89351247 TTGCAAAGGGAGAGGAATTAAGG - Intergenic
1132137576 15:99357905-99357927 CAGGAATAGGAGAGGAGTGAGGG + Intronic
1132441062 15:101864573-101864595 CTGAAAAAGTAGAAGAGTGATGG + Intergenic
1132945931 16:2531517-2531539 CTGTAGAGGGAGCGGAATGGTGG - Intergenic
1133114615 16:3570003-3570025 CTGTAAAATGGGAGAAATAATGG - Intronic
1133489284 16:6251337-6251359 CTGTAACAGGAGAATAATAATGG - Intronic
1133996933 16:10755335-10755357 TTGTAAAAGCACAGGAGTGAAGG - Intronic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1135343871 16:21671240-21671262 CTGTAAAATGAGATTAATGATGG - Intergenic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1135808526 16:25566422-25566444 CCGTAAAAGGAGAAAAAAGAAGG + Intergenic
1135891860 16:26364701-26364723 CTATAAAAGGAGAAGAATACTGG + Intergenic
1137880685 16:52044375-52044397 CTGTAAAAGGAGACAAAAGAAGG - Intronic
1140384363 16:74521511-74521533 GTGTAAGAGGAGAAGAATCAAGG + Intronic
1140644830 16:77018107-77018129 TTGTCAAAGGAGAGCAAGGAAGG - Intergenic
1141517596 16:84556424-84556446 CTGCAAAAAGAGAGGAGGGAGGG + Intergenic
1142368778 16:89666123-89666145 CTGGAAAACCAGAGGCATGAGGG + Intronic
1142504644 17:355121-355143 CTCAAAAAGGAAAGGAATGCTGG - Intronic
1142983348 17:3683965-3683987 GTGCACAGGGAGAGGAATGAGGG + Intronic
1143112898 17:4562698-4562720 CTCTAAGAGCAGAGGAATGTTGG - Intergenic
1143231520 17:5359610-5359632 CTTTAAAAGGAAAGAAATGGAGG + Intronic
1143818247 17:9537386-9537408 CTGTGACTGGAGAAGAATGAGGG - Intronic
1144430161 17:15183838-15183860 CTGTAAAAGCACAGCAAGGAAGG - Intergenic
1145881883 17:28357950-28357972 CCGTAGAAGAAGGGGAATGATGG - Intronic
1146210759 17:30941022-30941044 CTGTAACAGGAGATGAAACATGG - Intronic
1146448763 17:32954887-32954909 ATGTAAAAGGAGGGTGATGAGGG - Intergenic
1146530613 17:33604721-33604743 CGCTAAAAGGAGAGGATGGAGGG + Intronic
1146673405 17:34757166-34757188 CTGTAACATGGGAGGATTGAGGG - Intergenic
1146807738 17:35878640-35878662 CTGGAAGAGGAAAGGAAGGAGGG + Intronic
1146833886 17:36094341-36094363 CTTTAAAAAGAAAGGAAGGAAGG + Intergenic
1147770751 17:42866455-42866477 CAGTACAAGGGGAGGCATGAAGG + Intergenic
1148123610 17:45225841-45225863 CTGTAAAAAGAGAATAATAATGG + Intronic
1148978199 17:51547886-51547908 CTGTACAAGGTGAGGACTTAAGG + Intergenic
1149195329 17:54112743-54112765 TTGTAAAAGGAGATGAAACATGG + Intergenic
1149307272 17:55360248-55360270 CTGTAAAAGGAGATAAAACATGG - Intergenic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1149666423 17:58367974-58367996 CTGTAAAAGGGGAATAATAATGG - Intronic
1150297078 17:64017128-64017150 CAGTAAAAGGAAAGGAAGGAAGG + Intronic
1150786250 17:68165353-68165375 CTGTAAAAGGAAGGAAAGGAAGG + Intergenic
1151016032 17:70553964-70553986 TTGTAACAGGAGAGGAAACATGG - Intergenic
1151102024 17:71566894-71566916 CTGGAAAGGGAGAGGAAAGCAGG + Intergenic
1151341999 17:73477529-73477551 CTGTAAAATGGGAATAATGATGG + Intronic
1153147940 18:2055140-2055162 CTGTAAAAGGACAAAAAGGAAGG - Intergenic
1153342801 18:3992864-3992886 CTGTAAAAGAAAAGGAACGCTGG + Intronic
1153404446 18:4720598-4720620 CAGTAACAGAAGTGGAATGACGG + Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153771505 18:8420602-8420624 CTGTAAAAGGAGAAGAGACACGG - Intergenic
1154324295 18:13379076-13379098 CTGTAAAATGGAAGCAATGATGG - Intronic
1156580297 18:38367193-38367215 CTGAAAAAGGAGATAGATGAGGG + Intergenic
1157284037 18:46364993-46365015 CTGTGACAGGAGAAGAGTGAGGG + Intronic
1157543338 18:48528838-48528860 CTGTAAAATGAGAATGATGATGG + Intergenic
1157891440 18:51421811-51421833 CTGTAAAAGGAAAGGACTTTTGG - Intergenic
1158060921 18:53340416-53340438 CTGCAAAAGAAGATGAAAGAAGG + Intronic
1158197415 18:54904633-54904655 ATGTAACAGGACAAGAATGAGGG + Intronic
1158292530 18:55957502-55957524 TTCTCAAAGGAGAGGAATAAGGG + Intergenic
1159159390 18:64623669-64623691 CTTCCAAAGGAGAGGGATGAAGG + Intergenic
1159895543 18:73992238-73992260 CTGAAAAAGCATAGGGATGAAGG + Intergenic
1160643915 19:168885-168907 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
1160872044 19:1282122-1282144 ATGTGAATGGAGAGGAAGGATGG + Intergenic
1161181206 19:2883847-2883869 TTGTACAATGAGAGGAATGTAGG - Intergenic
1161856775 19:6770364-6770386 GTCTATAAGGAGAGGGATGATGG + Intergenic
1161920046 19:7259191-7259213 CTGTAAAAAGAAAGGAAGGAAGG - Intronic
1161956255 19:7497190-7497212 CTGCAAAAGGGGACTAATGATGG - Intronic
1163674486 19:18648625-18648647 CTGAGCAAGGAGAGGCATGAAGG - Intronic
1164960234 19:32421882-32421904 ATTTAAGAGGACAGGAATGAAGG + Intronic
1165960306 19:39528686-39528708 TTGGAAAAGAAGAGCAATGAGGG + Intergenic
1166330468 19:42075544-42075566 TATTAAAAGGAGGGGAATGAAGG - Intronic
1167572964 19:50301638-50301660 CTGTAGCAGGAGGGGAAGGAAGG - Intronic
1167888653 19:52522582-52522604 CTGAAAAAGGAGACCAATAAAGG + Intergenic
1167920357 19:52778410-52778432 CTGGAAAAGGAGACAAATAAGGG - Intronic
1167927451 19:52833131-52833153 CTGGAAAAGGAGACCAATAAGGG - Intronic
1167969862 19:53182467-53182489 CTGTAAAATGAGACGACTGTGGG - Intronic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925420859 2:3710354-3710376 CTGTCAGAGAGGAGGAATGAGGG - Intronic
925877428 2:8324935-8324957 CTGTAAAAGGAGGATAATAATGG - Intergenic
926410791 2:12600451-12600473 CTGTAACAGGAGATGAAACATGG + Intergenic
926962497 2:18373813-18373835 CTGTAACAGGAGAAGAAACATGG + Intergenic
927745120 2:25612000-25612022 CAGAAAAAGGAGAGAAATAAAGG + Intronic
928044471 2:27915036-27915058 GTGTAACATGAGAGGCATGATGG + Intronic
928216501 2:29365973-29365995 CTCTAAATGGAGGGAAATGAAGG - Intronic
928246050 2:29627914-29627936 CTGAAAGGGGAAAGGAATGAAGG + Intronic
928691170 2:33800677-33800699 CTGAAAAAGAAGAGTAACGAGGG - Intergenic
928728066 2:34198565-34198587 CTGTAACAGGAGATGAAACATGG + Intergenic
929391678 2:41475682-41475704 CTGGGAAAGGAGAAGAATTAGGG - Intergenic
929651512 2:43684356-43684378 CAGTTAAAGGAGAGAAAGGAAGG - Intronic
930666322 2:54102445-54102467 CTGCAATAGAAGAGGAATGAGGG - Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
931330059 2:61271560-61271582 CTTTAAAAGGAGAAGAAAGGAGG + Intronic
932047361 2:68363196-68363218 CTTTGAAAGGACAGGAATCAGGG - Intergenic
932673336 2:73756923-73756945 CTGTAAAAGGCCAGGCATGGTGG + Intergenic
934012175 2:87833585-87833607 ATGTATAAAGTGAGGAATGACGG - Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
936396210 2:112133508-112133530 CTGTAAAATGAGATTAATAATGG + Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938478965 2:131643478-131643500 GGGAAAAAGGAGAGGAAGGAAGG - Intergenic
938795078 2:134711883-134711905 AAGAAAAAGGAAAGGAATGAAGG - Intronic
939451076 2:142375808-142375830 CTGTAAAAGGATATTAACGAGGG + Intergenic
939729506 2:145764680-145764702 CTGTAAGAGAAGATGAAGGAGGG - Intergenic
940471356 2:154104524-154104546 CTGGAAAAGGAGGTGAAGGAGGG - Intronic
940558448 2:155263296-155263318 TTATAAGAGGAGAGGAAAGAAGG + Intergenic
941231067 2:162913259-162913281 CTGTAAACTGAGGGGATTGAGGG - Intergenic
941492476 2:166159466-166159488 CTGTTAAAGGAAAGGTAGGAAGG + Intergenic
941586174 2:167362436-167362458 TTGGAAAAGGAGGGGAATAAAGG - Intergenic
941882293 2:170493593-170493615 ATTCAATAGGAGAGGAATGAAGG - Intronic
942656774 2:178222023-178222045 TTGGGAATGGAGAGGAATGAAGG + Intronic
942810359 2:179992112-179992134 CTGTAAGAGGATAGGAAGGGAGG + Intronic
943053137 2:182940862-182940884 CTATAAAGGGAAAGCAATGAGGG - Intronic
943169820 2:184384592-184384614 CTTTAAAAGTGGAGGAAGGAGGG - Intergenic
943633053 2:190276018-190276040 CTGTAACAGGAGATGAAACATGG + Intronic
945148983 2:206768027-206768049 CGATCAAAGGAGAGGAGTGAGGG + Intronic
945287376 2:208096088-208096110 CTGACAAATGAGAGGAAGGATGG - Intergenic
945544139 2:211127859-211127881 ATGTAAGAGGAGTGGACTGAAGG - Intergenic
945672324 2:212817051-212817073 CTGGAAAAAGGTAGGAATGAGGG - Intergenic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946646404 2:221840628-221840650 CTGAAAAAGGAGAGTATTGGTGG - Intergenic
946959917 2:224973738-224973760 CTGTAAAATGAGAGTCGTGAGGG - Intronic
947159760 2:227201116-227201138 CTGTAAAAAGAGAGTCATTAAGG - Intronic
948400217 2:237678943-237678965 CTGTAAAATGGGAGGGATAATGG - Intronic
949030994 2:241797495-241797517 CTCCAAAAGGAGAGGAGTGCCGG + Intronic
1168896444 20:1326986-1327008 CTGGAAAAGGAGAGAAACCATGG + Intronic
1169131396 20:3167962-3167984 CTGCGAAATGGGAGGAATGAAGG + Intronic
1169575411 20:6954728-6954750 CTGTAAAAGAAGAAAAATAAAGG + Intergenic
1169790820 20:9408610-9408632 CTGTAAAAGAAAAGCAAAGATGG - Intronic
1170087115 20:12546009-12546031 CAGCAAGAGAAGAGGAATGAAGG - Intergenic
1170201275 20:13746898-13746920 TTTTAAAAGTAGAGGAATTATGG - Intronic
1170582408 20:17709376-17709398 ATGTGAGAGCAGAGGAATGAAGG + Intronic
1170802679 20:19603363-19603385 TTGGAAAAGGAGAGAAATTAGGG - Intronic
1171203755 20:23263491-23263513 TTGTAAAATGAGGGTAATGAAGG - Intergenic
1171978994 20:31613542-31613564 CTTTAAAAGGGAAGGAATGCCGG - Intergenic
1172028648 20:31966911-31966933 CTGTAAAATGGGAGGAAAAAAGG + Intergenic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172771196 20:37383638-37383660 CTGTAAAATGAGCGTAAGGATGG - Intronic
1173061271 20:39663951-39663973 CTGCACAAGGACAGGAATCACGG + Intergenic
1173302783 20:41818597-41818619 CTGTAAAATGGGAGTAATGATGG + Intergenic
1173431531 20:42991625-42991647 CTAGAAATGGATAGGAATGATGG + Intronic
1173887422 20:46472637-46472659 CTGAAAAAGAAGAGGGATAAAGG + Intergenic
1174130505 20:48340677-48340699 CTGTAAAATGGGTGGCATGATGG + Intergenic
1174740123 20:53004872-53004894 CTGTAAAATGGGAATAATGATGG - Intronic
1176359210 21:5980357-5980379 CTGTAAAAAGAGACAAAAGAAGG - Intergenic
1177246730 21:18534970-18534992 CTGTAAAAGAAAAGTAATAAGGG - Intergenic
1177895494 21:26852266-26852288 CTTTAAGAGGCTAGGAATGAGGG - Intergenic
1177918416 21:27121002-27121024 TTGTAAAAGGAAACAAATGATGG - Intergenic
1177929479 21:27263059-27263081 CTTTAAAAGGAAAGGCATCAAGG + Intergenic
1178079163 21:29045245-29045267 CTGTAATACCAGAAGAATGAAGG - Intronic
1178116987 21:29427638-29427660 CTGAATGAGGAGAGGTATGAGGG + Intronic
1178194978 21:30334350-30334372 CTGTAGAGGGATAGGATTGACGG - Intergenic
1178461805 21:32809130-32809152 CTGGGAAAGGAGAGGCATCACGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1178716911 21:34973327-34973349 CTGTGAATGGAGAAGAACGAGGG + Intronic
1178897878 21:36575395-36575417 CTGTAAAATGGGAATAATGATGG - Intronic
1179764308 21:43558193-43558215 CTGTAAAAAGAGACAAAAGAAGG + Intronic
1180164473 21:46016472-46016494 TTAAAAAAGGAGAAGAATGAAGG - Intergenic
1180164840 21:46019705-46019727 CTCTAAAAGGAGAGGGCTGAAGG - Intergenic
1180453169 22:15486405-15486427 CAGTAAGAGGAGAGGAATCAAGG + Intergenic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1182032924 22:27174480-27174502 CTGTAAGAGTGAAGGAATGAGGG + Intergenic
1182133217 22:27874423-27874445 CTGTCAAAGGAGGCGAAGGAGGG + Intronic
1183247776 22:36707134-36707156 CTGTAAAATGGGAATAATGATGG - Intergenic
1183419772 22:37704727-37704749 CAGGAAGAGGAGAGGAAGGAAGG + Intronic
1184331181 22:43828943-43828965 CTGTAAAAGGAGAGCAGGGAGGG + Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184621160 22:45678994-45679016 GTGTATAAGCAAAGGAATGAAGG - Intronic
1184699328 22:46159761-46159783 TTGGAAAATGAGAGGCATGAAGG + Intronic
950586871 3:13898667-13898689 CTGCAAGAGGAGGGGAATGCAGG + Intergenic
950684428 3:14606280-14606302 CTGCAGTAGGGGAGGAATGAAGG + Intergenic
950737708 3:15023731-15023753 CTTTAAAAGGAACGGAAAGAGGG + Intronic
951505247 3:23437600-23437622 CTCAGAAAGGAGAGGAATGCCGG + Intronic
951677860 3:25262311-25262333 GTGAAAAAGGAGAGGAGTGATGG - Intronic
952083505 3:29789670-29789692 ATTTAAAAGAAGAGGAATGATGG - Intronic
952083995 3:29795704-29795726 CTGTAAACTGGGAGGAAGGAGGG + Intronic
952504906 3:33998856-33998878 TTGTAGAAGAAGAGGAGTGAGGG + Intergenic
953161401 3:40423513-40423535 CTGTAAAATAAAAGGAATAAGGG + Intronic
953706384 3:45234188-45234210 CTGTAAAATGAGAATAATAATGG + Intergenic
953813731 3:46135815-46135837 CAGTAAATGGGGTGGAATGAAGG - Intergenic
954090191 3:48278048-48278070 CGGTAAATGGAAAGGAATCACGG + Intronic
954793213 3:53147893-53147915 CTGTAAAATGGGACTAATGATGG + Intergenic
954878041 3:53816049-53816071 TTTTAAAAGGAGAGGTGTGATGG + Exonic
956333740 3:68140633-68140655 CTGTAAAATGAAGGCAATGATGG + Intronic
956419026 3:69066351-69066373 CTGTAAAAGGTGGGGTATGGTGG - Intronic
956481112 3:69674837-69674859 CTGGAAAAGGCAAGGAAGGAGGG + Intergenic
956944579 3:74205745-74205767 CTCTAAAAGGATATGAATCAGGG + Intergenic
957582029 3:82086514-82086536 CAGTAAAAGTAGATGAATGATGG + Intergenic
958079467 3:88727953-88727975 CATTAAAAGGGGAGAAATGAAGG - Intergenic
958735755 3:98007628-98007650 CTGTAAAAGGAGAGGAATGATGG + Intronic
959452455 3:106520409-106520431 CTTTAAAGGCAGAGTAATGAAGG + Intergenic
959669530 3:108960409-108960431 CTGTAACAGGAGATGAAACATGG + Intronic
961259133 3:125585733-125585755 ATGGAAAAGGGGAAGAATGAGGG - Intronic
961587861 3:127948859-127948881 CAGTGAAAGGGGAGGAAAGAGGG + Intronic
961661047 3:128468964-128468986 CTGTAAAAGGGAAGTAATGATGG + Intergenic
962558554 3:136581300-136581322 CTGGAAATGAAGAGTAATGAAGG - Intronic
963101800 3:141614457-141614479 AAGTAACAGCAGAGGAATGAGGG - Exonic
963290759 3:143484861-143484883 CTGTAAAAAGAGACCAATAATGG + Intronic
963645239 3:147905347-147905369 CCGTGAAAGGAAAGGAATCAAGG + Intergenic
963812638 3:149794050-149794072 CTGGAAAAGAAGAGTAATGAGGG + Intronic
964081335 3:152761898-152761920 CTGAAAAATGAGTGGAATTATGG + Intergenic
964101785 3:152996130-152996152 CTGTCAAAAGAAAGGAAGGAAGG + Intergenic
965733288 3:171795086-171795108 CCGTAAAAGGAGGCCAATGAAGG - Intronic
965915507 3:173841692-173841714 CTGTAGAAGTAGAGGAGTCATGG + Intronic
966283779 3:178268653-178268675 GAGGAAAAGGAAAGGAATGAAGG - Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967008072 3:185403923-185403945 AAGTAAAAGGAAAGGAAGGAGGG - Intronic
967319039 3:188177641-188177663 CTGTAAAATGGGAGTAATGATGG + Intronic
967611675 3:191513391-191513413 CTAGAAAAGGGGAGAAATGATGG + Intergenic
967826648 3:193882544-193882566 TTTTAAGAGGACAGGAATGAGGG - Intergenic
968586041 4:1416495-1416517 CAGGAAAAGGAGAGGAAGGGTGG - Intergenic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969202436 4:5616585-5616607 CTGTAAAATGGGTGTAATGAGGG - Intronic
970347850 4:15170799-15170821 CTGCAAAGGGAGAGCAAAGAGGG + Intergenic
970573106 4:17402062-17402084 CTATAAAATGGGAGAAATGATGG - Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971595381 4:28520996-28521018 AGGTAGAAGGAGAGGAAGGAAGG - Intergenic
972139258 4:35936491-35936513 CTGTAAAATGGGAATAATGATGG + Intergenic
972337592 4:38121513-38121535 TTGAAAAAGGAGAGGAGAGAAGG + Intronic
972641069 4:40925361-40925383 CTGCAAAATGAGGGTAATGATGG - Intronic
972671779 4:41219416-41219438 CTGAAATAGGAGTGGAAGGAAGG - Intergenic
972938884 4:44172598-44172620 CTGCAAAAGGCAAGGAATCAAGG - Intergenic
973643414 4:52925979-52926001 CAGTAAATGGAGAAGAGTGAGGG - Intronic
974212359 4:58795583-58795605 CTGTAAATTGAGAAGAAAGAAGG + Intergenic
974404510 4:61448682-61448704 CAGTAGAAGGATAGGAACGAAGG + Intronic
974546264 4:63311656-63311678 TTTCAAAAGGAGAGAAATGATGG - Intergenic
974877441 4:67716325-67716347 CTGGAAACGCAGAGGCATGATGG + Intergenic
974920599 4:68234262-68234284 CTGAAGAATGATAGGAATGAGGG - Intronic
975337604 4:73198030-73198052 CTCTAAAGTTAGAGGAATGATGG - Intronic
975681792 4:76884811-76884833 TTGTAAAAGAAGAGGAAACAAGG + Intergenic
975932021 4:79536520-79536542 TGGAAAAAGGAGAGGAATGGTGG + Intergenic
975932029 4:79536623-79536645 AGGAAAAAGGAGAGGAATGGTGG + Intergenic
976155518 4:82140159-82140181 CTGTAAAAGTATAGGAATGGCGG + Intergenic
976327909 4:83793716-83793738 CTGTAAGAAGAGAGCATTGAGGG - Intergenic
976398290 4:84581498-84581520 CTGTAAACGGATAGTAAGGATGG - Intergenic
976777779 4:88724782-88724804 CAGTAAAAGGAAATTAATGAAGG + Intergenic
977612812 4:99053751-99053773 ATGTACAAGGAGATGAATGTTGG - Intronic
977750413 4:100603195-100603217 CTGGAAAAGGAGAGGAAGTCAGG - Intronic
977961017 4:103085567-103085589 TTTTAAAAGGGGAGGAATGTGGG - Intronic
978082159 4:104606446-104606468 CTGTGAAGGGAAAGGAGTGAGGG + Intergenic
978200194 4:106016758-106016780 CAGTACAAGGGGAGGAAAGAAGG + Intergenic
978445167 4:108773221-108773243 ATGCATAAGGAGAGGTATGAGGG - Intergenic
978490923 4:109311171-109311193 CTGTAACAGGAGATGAAACATGG + Intergenic
978724713 4:111956572-111956594 TTGGGCAAGGAGAGGAATGAGGG - Intergenic
978850929 4:113335528-113335550 CTTTGAAATGAGAGGCATGAGGG - Intronic
979359892 4:119749203-119749225 CTGTAACAGGAGATGAAACATGG - Intergenic
980651660 4:135724887-135724909 TTGTAACAGGAGATGAAAGATGG - Intergenic
981655212 4:147105086-147105108 CTGTAAAAGGAGAAGGGTAAGGG - Intergenic
981712126 4:147719849-147719871 CTGTAAATGGATAGTAGTGATGG - Intergenic
981936596 4:150246358-150246380 TTTTAATAGGAGAGGAATGAGGG + Intronic
982380514 4:154743601-154743623 CTCTAAAAGGATAGATATGAGGG - Intronic
982849012 4:160288277-160288299 CTATAAAAGGAGGCAAATGATGG - Intergenic
983021663 4:162684416-162684438 CTGAAAGAGGAGGGGAAGGAAGG + Intergenic
983271622 4:165568743-165568765 CTGTAAAAGGGAAGGAGAGATGG + Intergenic
983607647 4:169608168-169608190 TTGAAAAAGAAGAGCAATGAAGG + Intronic
984300877 4:177916279-177916301 CTGTAAAGGTAGTGTAATGAAGG - Intronic
984323236 4:178221311-178221333 CTGTAAAAGGGAAGAAAAGAAGG + Intergenic
984891652 4:184499256-184499278 TTGTAACAGGAGAGGAAACATGG + Intergenic
986512483 5:8523127-8523149 CTGGAAAAAGAGGGGAATAAGGG - Intergenic
986715512 5:10520966-10520988 CTCTAGAAGGAGAGGAAAGGAGG - Intronic
987719547 5:21616417-21616439 CTGTATAAGGCAAGGTATGAGGG - Intergenic
988787146 5:34575552-34575574 CTGTCAAAGAAGAGGGGTGATGG - Intergenic
988969368 5:36450694-36450716 CTGTAATAAGATAGGAATGTAGG - Intergenic
989223124 5:38992244-38992266 CTGAAAAAGGAGAGAAAGAAAGG + Intronic
989428437 5:41323785-41323807 ATGTAGAAGGAGAGGAAGAAAGG + Intronic
989594125 5:43140418-43140440 CTGTCAAATGAGAGTAATAACGG + Intronic
989625173 5:43422680-43422702 CAGAAAAAGGAGAGCAGTGAGGG + Intergenic
990074331 5:51824554-51824576 GGGGAACAGGAGAGGAATGAGGG - Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990330754 5:54723195-54723217 ATGCAAAAGGAAAGGAAGGAAGG + Intergenic
990425278 5:55682078-55682100 CGGGCAAAGGAGATGAATGAGGG + Intronic
991234449 5:64377687-64377709 CTGTAAAAGCAGAGGAGTTCTGG - Intergenic
992853229 5:80832634-80832656 CTGTAAATGGAAAGTAGTGATGG + Intronic
993562913 5:89433768-89433790 CTCCAAAATGAGAAGAATGATGG - Intergenic
993763961 5:91832522-91832544 GTATTAAAGGAGAGCAATGATGG - Intergenic
993775295 5:91987129-91987151 CTGTATAAGGATAGAAATAATGG + Intergenic
996236164 5:121132826-121132848 CATTAAAAAGAGAGGAAGGAGGG + Intergenic
996565461 5:124875486-124875508 ATGTACAAAGAGAGAAATGAAGG + Intergenic
997195703 5:131977936-131977958 CATCAAAAGGGGAGGAATGAAGG + Intronic
997286344 5:132681415-132681437 ATGTAAATGGAGAGGCAGGAAGG + Intronic
997444888 5:133933723-133933745 CAGGGAAAGAAGAGGAATGAAGG - Intergenic
998817224 5:146026826-146026848 CTGTAAAATGGGACTAATGATGG + Intronic
999404874 5:151298105-151298127 CTTTAAAAAGACAGAAATGAGGG + Intronic
999522476 5:152364874-152364896 CAGTCAAATGAGAGGAAAGATGG - Intergenic
999945499 5:156591095-156591117 ATGTAAAAGGAGAGTATTGAAGG - Intronic
1000006281 5:157187757-157187779 CTGTAAAAGGCAAGGAAGGAGGG - Intronic
1000188343 5:158882991-158883013 TAGTAAAACAAGAGGAATGAAGG - Intronic
1000278724 5:159763763-159763785 TTGTAAAGGGAAATGAATGACGG - Intergenic
1001041550 5:168339268-168339290 CTCTAAGAGCAGAGGGATGAGGG + Intronic
1001425821 5:171621744-171621766 CAGTAAGAGGTGAGGTATGATGG - Intergenic
1001565088 5:172694956-172694978 CTGTAAAATGAAGGTAATGATGG - Intergenic
1001714427 5:173803147-173803169 CTGTAAAAGGAGGATAATAACGG + Intergenic
1002286246 5:178164554-178164576 CCGTCAACGGAGTGGAATGACGG + Intergenic
1002654184 5:180729975-180729997 TTTAAAAAGAAGAGGAATGAGGG + Intergenic
1002733006 5:181355894-181355916 CTGAAAAAGTAGAAGAGTGATGG + Intergenic
1002751532 6:118210-118232 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
1003201228 6:3962902-3962924 ATGGAAAACAAGAGGAATGATGG + Intergenic
1003491213 6:6623553-6623575 GTGAAAAAGCAGAGGAAAGAGGG + Intronic
1004450556 6:15741392-15741414 CTGTAAAAGGAGATTACTAATGG + Intergenic
1005363847 6:25057574-25057596 ATGCAAAAGGAGAGGTATAAAGG - Intergenic
1006389432 6:33749805-33749827 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006389802 6:33751675-33751697 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006552106 6:34833017-34833039 TGGCAAAAGGAGAGGAATGAAGG - Intronic
1007373586 6:41442319-41442341 CTGTAGGAGGAGAGGAAGTAGGG + Intergenic
1007734631 6:43972906-43972928 CTCTAGCAGGTGAGGAATGAAGG + Intergenic
1007825581 6:44598301-44598323 CTGAAAAAGCAGAGAAATGAGGG - Intergenic
1007898062 6:45382941-45382963 CTAGAGAAAGAGAGGAATGAAGG + Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1008678102 6:53843181-53843203 ATGTAATAGGAGAGAAATAAAGG - Intronic
1010373904 6:75144142-75144164 CTGGAACAGTAGAGGAATGGAGG - Intronic
1010417904 6:75635780-75635802 CAATAAAAGGAGAGTAATTAGGG + Intronic
1011002583 6:82607586-82607608 CTGTAAAATGGGAATAATGATGG - Intergenic
1011647080 6:89469924-89469946 CTGTAGAAGGAGAAGAATCTGGG - Intronic
1011723911 6:90188975-90188997 TTGTAAAAAGAGAGTAATTACGG - Intronic
1011763091 6:90589373-90589395 GTTTAAATGCAGAGGAATGATGG + Intergenic
1012137304 6:95574398-95574420 ATGTAACAGAAGGGGAATGAAGG - Intergenic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1012981969 6:105840660-105840682 CTGTAGAAGGAGGGAGATGAGGG - Intergenic
1013540862 6:111107643-111107665 TTGTAATAGGAGAGGAAACATGG + Intronic
1014119164 6:117703128-117703150 CTGTAAAATGAGGTGCATGAGGG + Intronic
1014155534 6:118104964-118104986 CTGTGAAAAGACAGGAGTGAAGG - Intronic
1014482701 6:121957380-121957402 ATGTAAAATGAGAGAAATAATGG + Intergenic
1014495002 6:122110616-122110638 CTGAAAAAGGGAAGGAAAGAAGG + Intergenic
1015002087 6:128230161-128230183 CAGGAAATGGAGAGGAAAGAGGG + Intronic
1015115584 6:129645614-129645636 TTGTAAAAGGTGAGAAATGCGGG - Intronic
1015480651 6:133704338-133704360 CAGTAAAAGGAGAAAACTGAAGG - Intergenic
1016278921 6:142389768-142389790 GAGGAAAAGGAGAGGAATTAGGG + Intronic
1017195228 6:151693446-151693468 GTCACAAAGGAGAGGAATGATGG - Intronic
1017587342 6:155941571-155941593 GTGGAGATGGAGAGGAATGAAGG - Intergenic
1017609410 6:156168495-156168517 CTGTAAAATGATAGCAATAATGG + Intergenic
1019106584 6:169672724-169672746 AAGAATAAGGAGAGGAATGAGGG + Intronic
1019237258 6:170628211-170628233 CTGAAAAAGTAGAAGAGTGATGG + Intergenic
1019362587 7:612594-612616 CTATTAGAGGAGAGGAAGGAAGG + Intronic
1019895827 7:3982333-3982355 ATGTACAAGGAGATGAATGTGGG + Intronic
1020666290 7:11047860-11047882 CGGGAAAAAGAGAGGAAGGAAGG + Intronic
1021265610 7:18517480-18517502 CTGTAAAAGAGGAGAAATGGAGG - Intronic
1022009047 7:26292801-26292823 CTGTAAAATGAAAGGTTTGATGG - Intronic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022149936 7:27591948-27591970 TTGTAAATGGAGAGGAAAGTGGG - Intronic
1022454846 7:30549411-30549433 CTGTAAAATGAGGAGAATGATGG + Intronic
1022526288 7:31039661-31039683 CTGTAAAATGTGAAGAATAATGG - Intergenic
1022589909 7:31651615-31651637 CTGTAAAGGGAGAGGCATACGGG + Intronic
1023040169 7:36165993-36166015 CTGTAAACGGAGAGGGATTCAGG + Intronic
1023054525 7:36280773-36280795 TTGTAAAAGCAGCGGATTGAAGG - Intronic
1023063067 7:36347805-36347827 TCTGAAAAGGAGAGGAATGAAGG - Intronic
1023119698 7:36897020-36897042 CTGTAAAATGAGGGGAGTGGAGG - Intronic
1025265615 7:57454464-57454486 CTGCAAAAGGAGATTATTGAAGG + Intronic
1025747178 7:64253347-64253369 CTGCAAAAGGAGGTTAATGAAGG + Intronic
1027376049 7:77550978-77551000 CTGTAATAGGAGATGAAACATGG - Intronic
1029090746 7:98046200-98046222 CCTTATAAGAAGAGGAATGAGGG + Intergenic
1030151596 7:106411771-106411793 AGGAAAAAGGAGAGGAGTGAGGG + Intergenic
1030297049 7:107939692-107939714 CAGTAAAATGGGAGGAATGCTGG - Intronic
1030862302 7:114649447-114649469 CTGAAAAATGAGAGGATTGGTGG - Intronic
1032262321 7:130347410-130347432 GTGTAAAATGAAAGGAATGAAGG - Intronic
1032443130 7:131957662-131957684 CTGTAAAAGGAGGGGACTGTAGG + Intergenic
1033441875 7:141387550-141387572 ATTTAAAAAGACAGGAATGAGGG - Intronic
1033706372 7:143889555-143889577 CTGTAACAGGAGAGGAAACATGG + Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1035245365 7:157559433-157559455 CTGGACGAGCAGAGGAATGAGGG + Intronic
1035510510 8:178396-178418 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
1035816814 8:2550173-2550195 CTGTAAAACAGGAGCAATGATGG + Intergenic
1036592884 8:10184895-10184917 CTGTGAAAGGAAAGAAATCAAGG + Intronic
1037063294 8:14543632-14543654 CTGTAAAAACTGAGGAATCACGG + Intronic
1037626920 8:20616172-20616194 CTGTATAAGGAGAATAGTGAAGG - Intergenic
1039051528 8:33499031-33499053 AGGTAAAAGGAAAGGAAGGAAGG + Exonic
1039438440 8:37577854-37577876 CTGTAAAATGTGAGTAATAATGG + Intergenic
1041056147 8:53988580-53988602 TGGTATAAGGAGAGGGATGAAGG + Intronic
1041114103 8:54517632-54517654 CTGGAAAAGGAGGGGATTGCAGG + Intergenic
1041126335 8:54644085-54644107 CTGTGAATGGAGAGGAATTTTGG - Intergenic
1042263366 8:66883356-66883378 TCTTAAAAGGAGAAGAATGAGGG + Intronic
1042550292 8:69988442-69988464 TTTTAAAAAGAAAGGAATGAAGG + Intergenic
1042622989 8:70726577-70726599 CTGTAACAGGAGATGAAACATGG + Intronic
1042823486 8:72957037-72957059 CTAAAAAAGGAAAGGAAGGAAGG + Intergenic
1043779264 8:84311717-84311739 CTGAAAATGAAGAGTAATGAAGG + Intronic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044852577 8:96443441-96443463 CTGGAAGAAGACAGGAATGATGG - Intergenic
1044889640 8:96819835-96819857 CTGTAACAGGAGATGAAACATGG - Intronic
1045008530 8:97937028-97937050 CTGGAGAAGGAGAGGAGTGGAGG - Intronic
1045497848 8:102723241-102723263 CTGTAAAAGAGGAAGAATAATGG - Intergenic
1045585578 8:103531534-103531556 ATGTAAAGGGTGAGGTATGAGGG - Intronic
1045960761 8:107965361-107965383 CTGTAAGAGGATAGGAGAGAGGG - Intronic
1046344134 8:112900724-112900746 CTTTAAAAGAAGAAGAATGAGGG + Intronic
1046427567 8:114074821-114074843 GTGAAAAGGTAGAGGAATGAAGG + Intergenic
1046789422 8:118305218-118305240 CTGAAAAGGGATAGCAATGATGG - Intronic
1046943392 8:119952913-119952935 CTGGAAAAGGTGAGGAACAAGGG - Intronic
1047545823 8:125815128-125815150 CTGTAAAAGGACAGTAATAATGG - Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1049933028 9:474424-474446 CTATAAAATGAGATGTATGAGGG + Intronic
1051044095 9:12852780-12852802 CTCTAATGGGAGAGCAATGAGGG - Intergenic
1051413762 9:16817635-16817657 CTGGCAAGGGAGAGGAATGAAGG - Intronic
1051714614 9:19969252-19969274 ATGAAAAAGGAAAAGAATGAAGG - Intergenic
1051844143 9:21432751-21432773 CTGGCAAAGAAGAAGAATGAAGG - Intronic
1052374264 9:27700077-27700099 CTTTAAATGGAGAAAAATGAGGG + Intergenic
1052416495 9:28184554-28184576 ATGTAAAGGGGGAGGAAGGAGGG + Intronic
1054922592 9:70556809-70556831 CTGTAAAATGGGAGTAATAATGG + Intronic
1055819452 9:80244407-80244429 CTGTATAAAGAGAGTAAGGATGG + Intergenic
1056442677 9:86636319-86636341 GTGCAGAAGGAAAGGAATGAGGG + Intergenic
1057472824 9:95373061-95373083 CTGCAAAAGGTGAGGAAAGTAGG - Intergenic
1057743234 9:97730604-97730626 CAGTAAAAAGAAAGGAAGGATGG - Intergenic
1058716507 9:107727095-107727117 GAGAAAAAGGAGAGGAAAGAAGG - Intergenic
1059801118 9:117750485-117750507 CTGTACTTGGAGAGGAAAGATGG - Intergenic
1061238433 9:129355371-129355393 CTGTAAAATGGGAAGAATAATGG - Intergenic
1061696129 9:132374936-132374958 CTGTAAAAAGGAAGGAAGGAAGG - Intergenic
1062054143 9:134462264-134462286 CTGTAAAATGAGAGTATTGATGG + Intergenic
1062757412 9:138308220-138308242 CTGAAAAAGTAGAAGAGTGATGG + Intergenic
1185772190 X:2773278-2773300 AGGAAGAAGGAGAGGAATGAAGG + Intronic
1185956732 X:4498877-4498899 CTGTAACAGGACAGGAAAGATGG + Intergenic
1187028874 X:15465096-15465118 CTGCAAAAGTAGAGGAAAGGGGG - Intronic
1187503756 X:19862070-19862092 CTGTAACAGGAGATGAAACACGG - Intronic
1187733184 X:22277572-22277594 CTGTAAAACGTGAGGCAGGAAGG - Intergenic
1187932087 X:24302794-24302816 CTATAAAAGGAGAGCAGTAAGGG - Intergenic
1188153849 X:26716223-26716245 CTGTAACAGGAGATGAAACATGG - Intergenic
1189197126 X:39162157-39162179 ATGGGAAAGGAGAGGAAAGAAGG - Intergenic
1189227850 X:39428270-39428292 CTTGAAATGCAGAGGAATGAGGG - Intergenic
1189296403 X:39921359-39921381 TTGCAAAAGGGGAGGAACGATGG - Intergenic
1190550025 X:51570417-51570439 CTGTTAGAGCAGAGGAAAGATGG + Intergenic
1190778436 X:53574190-53574212 ATGTAAAAGGAGGGAAATGGAGG - Intronic
1190876383 X:54463122-54463144 GTGTAAAAGGAGGGGAAAGGGGG - Intronic
1191663957 X:63678810-63678832 CTGTAAAAGAAGGGTAATAAGGG + Intronic
1191998063 X:67117797-67117819 CTGAAAGAGGTGAGGTATGAAGG - Intergenic
1192831538 X:74755710-74755732 CTGCAAAAGGAGTGTGATGAGGG - Intronic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1193777527 X:85661936-85661958 CTGTAAACTGAGAGTAATGTGGG + Intergenic
1194818336 X:98473198-98473220 CTGTAAAAGGGGAAAATTGACGG + Intergenic
1194979366 X:100424566-100424588 CTGGGAAAGGAGAGAAATGTGGG + Intergenic
1195706115 X:107739036-107739058 CTGGGAAAGGAGAGGAAATAAGG + Intronic
1196063908 X:111441806-111441828 CTGGAAAGGGAGAGAAATGGGGG + Intergenic
1197658359 X:129142675-129142697 CAGTAATGGAAGAGGAATGAAGG + Intergenic
1197992822 X:132336261-132336283 CTGTAACAGGAGATGAAACATGG + Intergenic
1198338035 X:135687697-135687719 AAGCAGAAGGAGAGGAATGATGG + Intergenic
1198394829 X:136210145-136210167 CTGTAAAATGGGAGAAAAGACGG - Exonic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1199132308 X:144204958-144204980 ATGTATAAAGTGAGGAATGACGG + Intergenic
1199195514 X:145025055-145025077 CTGTAAAAGTAAATGAAAGAAGG + Intergenic
1199418563 X:147615976-147615998 CTGTGAAAGGAGAGTGATAATGG + Intergenic
1200268106 X:154657194-154657216 CTGCAAAAGAAGAGGAAATATGG - Intergenic
1201511362 Y:14768155-14768177 CAGAAAAAGGAGATGAGTGATGG - Intronic