ID: 958744208

View in Genome Browser
Species Human (GRCh38)
Location 3:98113471-98113493
Sequence ATGTGTCTTGGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958744208_958744217 8 Left 958744208 3:98113471-98113493 CCCTCCACCTTCCCAAGACACAT No data
Right 958744217 3:98113502-98113524 CAAACTCAATTCCAAGCTTCGGG 0: 35
1: 69
2: 90
3: 62
4: 214
958744208_958744220 25 Left 958744208 3:98113471-98113493 CCCTCCACCTTCCCAAGACACAT No data
Right 958744220 3:98113519-98113541 TTCGGGTAAAAACCCAAGGAAGG No data
958744208_958744216 7 Left 958744208 3:98113471-98113493 CCCTCCACCTTCCCAAGACACAT No data
Right 958744216 3:98113501-98113523 CCAAACTCAATTCCAAGCTTCGG 0: 34
1: 43
2: 32
3: 25
4: 158
958744208_958744219 21 Left 958744208 3:98113471-98113493 CCCTCCACCTTCCCAAGACACAT No data
Right 958744219 3:98113515-98113537 AAGCTTCGGGTAAAAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958744208 Original CRISPR ATGTGTCTTGGGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr