ID: 958751524

View in Genome Browser
Species Human (GRCh38)
Location 3:98197276-98197298
Sequence CTGGAAAATACCCCTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 4, 2: 2, 3: 15, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958751524 Original CRISPR CTGGAAAATACCCCTGTTCC TGG Intronic
900581734 1:3412926-3412948 CAGGAAGATGCCCCTGTTCTTGG + Intronic
901394159 1:8968304-8968326 GTGGAAAAGACCCCTGCTCAAGG + Intronic
902512168 1:16972461-16972483 CTGGAGAACACCCCTGTGCCTGG + Exonic
902601118 1:17540511-17540533 CTGACATATATCCCTGTTCCAGG - Intronic
905546660 1:38805144-38805166 CTGGAGAAGACGCCTGTACCTGG + Intergenic
905773286 1:40652184-40652206 CTGGAGAATACCACTACTCCTGG + Intronic
906475823 1:46168732-46168754 CTGGAAAGTCCCCCTGCCCCTGG + Intronic
909712586 1:78668719-78668741 CTGGTAACTACCCCAGTTACAGG + Intergenic
910965339 1:92802693-92802715 CTTTAAAATACTCCAGTTCCAGG - Intergenic
912263326 1:108130791-108130813 ATGGAAAATACCTCAGTTTCTGG - Intergenic
913340580 1:117754129-117754151 CTGGAAAACACCTCAGTCCCAGG + Intergenic
916177344 1:162053500-162053522 CTGGAAAAACAACCTGTTCCTGG - Intergenic
920127249 1:203703117-203703139 CTGGAAAATACCCTGGGTCTGGG + Intronic
922514644 1:226197943-226197965 CTCAAAAATACCCCTCCTCCAGG - Intergenic
923398073 1:233587314-233587336 CTGGCAGAAACCCCTGTTCCTGG - Intergenic
1064739648 10:18419601-18419623 CTGGACAAGACCCCTTTTCCAGG - Intronic
1067380942 10:45772815-45772837 CTGGGAAATGACCCTGTGCCTGG - Intronic
1067888640 10:50113454-50113476 CTGGGAAATGACCCTGTGCCTGG - Intronic
1068188423 10:53617837-53617859 CAGGAAAATACCACCGTGCCTGG - Intergenic
1070515361 10:77200458-77200480 CTGGGAAATACCCCTTCTTCAGG + Intronic
1071228708 10:83561750-83561772 CTGGGAGATACTACTGTTCCCGG - Intergenic
1072525927 10:96271540-96271562 CTGGCAAACACCCCTGCTCTAGG + Exonic
1074424025 10:113335372-113335394 CTTGAAAATACCCCTGTGAGGGG + Intergenic
1076516306 10:131046695-131046717 CTGGAAGGGACCCATGTTCCAGG + Intergenic
1081751352 11:45513485-45513507 CTGGGACATACCCCTGTGCCAGG + Intergenic
1083448835 11:62728725-62728747 CAGGAAATTACCCTTCTTCCTGG - Exonic
1083571874 11:63765450-63765472 CTGGAATCTAGCCCTGTCCCTGG + Intronic
1084969530 11:72763123-72763145 CTGGGAAATCCCCCAGTCCCAGG + Intronic
1085715915 11:78873110-78873132 CTGGAAAATACCCATGGGACTGG - Intronic
1090645658 11:128764953-128764975 CTGGAAAATGGCCCTGTCCTCGG - Intronic
1090658174 11:128861580-128861602 CAGAAACATACCCCTGCTCCTGG + Intronic
1100913333 12:99390289-99390311 CTGGAAACTGCTCCTCTTCCAGG + Intronic
1101131498 12:101695953-101695975 CTGGAACATTACCATGTTCCAGG + Intergenic
1101647228 12:106642808-106642830 CTGCAACATTCCCCTGTCCCTGG - Intronic
1103867921 12:124068111-124068133 CTGCAAAATACCCCTTTTAGAGG + Intronic
1108372254 13:49781771-49781793 CTGGGAACTACCTCAGTTCCAGG + Intronic
1108456255 13:50617078-50617100 CTTGAAAATAGCCCAGCTCCTGG + Intronic
1108676776 13:52743880-52743902 CTGGAAAATTCCCCTTCTCTCGG - Intergenic
1113219860 13:108087458-108087480 TTGCAATTTACCCCTGTTCCAGG + Intergenic
1114130900 14:19790688-19790710 CAGAAAAATGTCCCTGTTCCTGG - Intronic
1114688972 14:24562749-24562771 CTGCAATATACCCCTGCTCTAGG + Intergenic
1118015019 14:61651626-61651648 CTGGAAAATACCCATTTGCCTGG + Intronic
1118292400 14:64539147-64539169 CTGGAAAATACCCTGGCACCAGG - Intronic
1118690821 14:68338227-68338249 CTTGTAAATGCTCCTGTTCCAGG - Intronic
1120991469 14:90381223-90381245 CTGGAAAACCCCTCTGTCCCAGG - Intergenic
1121219417 14:92274688-92274710 CTGGAGAATCTCCCTGTCCCAGG + Intergenic
1121229052 14:92342906-92342928 CTGGAAAACACCCTTGTTCATGG - Intronic
1123573952 15:21646316-21646338 ACAGAAAATATCCCTGTTCCTGG - Intergenic
1123610568 15:22088901-22088923 ACAGAAAATATCCCTGTTCCTGG - Intergenic
1124612388 15:31216814-31216836 CTGGAAGAGTCCCCTGTGCCAGG + Intergenic
1125423286 15:39525794-39525816 CATGAAAATACTCCTGCTCCTGG - Intergenic
1125902595 15:43362752-43362774 ATGGTAAATACCCCTGTTGGAGG - Intronic
1127725419 15:61744772-61744794 CTGGGAAATGCTCCTGTTGCTGG - Intergenic
1131403780 15:92147042-92147064 CTGGAAAATGCCCCAGTCCTGGG + Exonic
1202982816 15_KI270727v1_random:380656-380678 ACAGAAAATATCCCTGTTCCTGG - Intergenic
1138021395 16:53485268-53485290 CTGGAAAATCCCCCAATTCTTGG + Intronic
1138361385 16:56431490-56431512 CAGGAAAATAGCCCTGTGACTGG + Exonic
1139357840 16:66377826-66377848 GTAGAGAAAACCCCTGTTCCTGG + Intronic
1141690528 16:85593953-85593975 CTGGAAAATTGCCCGGTTGCTGG + Intergenic
1142320165 16:89376993-89377015 CTGGAAAGAACCCCTTTTTCCGG + Intronic
1142744020 17:1946138-1946160 CTGGAAAACCCCTCTGTCCCAGG - Intronic
1144295870 17:13874580-13874602 CTGACAGATAACCCTGTTCCAGG + Intergenic
1148200669 17:45748066-45748088 CTGGAAATTCCCCCAGTTCCGGG - Intergenic
1149537708 17:57445162-57445184 CTGGTAAATACCCCCGAGCCAGG + Intronic
1151496322 17:74460313-74460335 CTGGAGGCTTCCCCTGTTCCTGG + Intergenic
1155002745 18:21703397-21703419 CAGGAAAATACCCCAGCTGCAGG - Intronic
1155138785 18:23023652-23023674 CTGGACATTACCACTATTCCAGG + Intronic
1156696500 18:39774098-39774120 CTGGGAAATGTCCCTGTGCCAGG - Intergenic
1158445469 18:57516899-57516921 TTGGAACATACCCATGTACCTGG - Intergenic
1159517722 18:69479167-69479189 CTGGCAAATACCCTATTTCCTGG - Intronic
1163067569 19:14810238-14810260 CTGGAAATGACCCCTCTTCCAGG + Intronic
1165401257 19:35601966-35601988 GGGGAAAATACCCCTGCCCCTGG - Intergenic
1202646172 1_KI270706v1_random:144105-144127 CAGGAAAATACCACTATGCCGGG + Intergenic
925274939 2:2641928-2641950 GTGCCAGATACCCCTGTTCCTGG - Intergenic
926691699 2:15739334-15739356 CTGGAACTTTCACCTGTTCCTGG - Intronic
926796728 2:16625635-16625657 GTGGAAAACATCCCTGTGCCAGG - Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
929047400 2:37803425-37803447 CTGGAAAATACAAATATTCCAGG + Intergenic
929596579 2:43180000-43180022 CTGGAAAATCCCTCTGAGCCTGG - Intergenic
930210003 2:48626501-48626523 TGGGAAAATACCCATGTTCATGG - Intronic
930448389 2:51503409-51503431 CTGGAAAATACACTGCTTCCCGG + Intergenic
931663778 2:64595358-64595380 CTGGGAAATACCTCTATTCTGGG + Intergenic
934509306 2:94924535-94924557 CAGGAAAATACCACTATCCCTGG + Intergenic
935075505 2:99739290-99739312 CTGAAAAATACCCCTGAACAGGG - Intronic
935670894 2:105556482-105556504 CAGAAAAAAACCCCTCTTCCTGG + Intergenic
936835355 2:116703165-116703187 CTGGAATATACCCCAGATCGAGG + Intergenic
940954684 2:159714006-159714028 TGGGAAAATAGCCCTCTTCCAGG - Intronic
946518601 2:220441253-220441275 ATGGAATATTCCCATGTTCCAGG - Intergenic
947005765 2:225509364-225509386 GTGGAAGATATCCCTGATCCTGG - Intronic
1169330839 20:4715017-4715039 CTGGAAATTCCCTCTGTCCCTGG + Intergenic
1170681488 20:18529752-18529774 CTGGAAAATGTCATTGTTCCAGG + Intronic
1172413230 20:34742093-34742115 CTGGCCAATCCCCCTGTACCTGG - Exonic
1173168640 20:40704425-40704447 CTGGAAAATGGGCCTGGTCCGGG + Intergenic
1176605704 21:8828656-8828678 CAGGAAAATACCACTATGCCGGG - Intergenic
1178817741 21:35946795-35946817 GGGGAACATACCCCTGTCCCAGG - Intronic
1180014081 21:45071737-45071759 CTGGAAAATAAACCTGATGCTGG - Intergenic
1180348001 22:11720260-11720282 CAGGAAAATACCACTATGCCGGG - Intergenic
1180355778 22:11838363-11838385 CAGGAAAATACCACTATGCCGGG - Intergenic
1180382476 22:12153962-12153984 CAGGAAAATACCACTATGCCGGG + Intergenic
1182480537 22:30606176-30606198 CTGGCAAGTACCCCTGCTTCTGG + Intronic
1183451562 22:37898779-37898801 CTGGAAAATACACCTGGGACTGG - Intergenic
1184363463 22:44032893-44032915 CTGGAAAAGGCTCCTGTTCTGGG - Intronic
1184670026 22:46007504-46007526 CCGGAAAAGACTCATGTTCCAGG + Intergenic
951075141 3:18381908-18381930 TTGGAAAATAATACTGTTCCTGG - Intronic
956555954 3:70522739-70522761 CTGGAAAATGCCCCAGCTCACGG - Intergenic
958745814 3:98132763-98132785 GTGGAAAATACCCCTGTTCCTGG + Exonic
958747067 3:98149451-98149473 GTGGAAAATACCCCTGTTCCTGG + Exonic
958748705 3:98168765-98168787 GTGGAAAATACCCCTGTTCTTGG + Exonic
958751524 3:98197276-98197298 CTGGAAAATACCCCTGTTCCTGG + Intronic
958753522 3:98222115-98222137 ATGGGAAATACCCCTGTTCCTGG + Intergenic
958754813 3:98238417-98238439 GTGGAAAATACCCCTGTTCCTGG + Intergenic
958757253 3:98264398-98264420 CTGTAAAATACCGCTCTTCCTGG + Exonic
958758862 3:98282968-98282990 GTGGAAAATGCCCCTGTTCTTGG + Exonic
958761335 3:98311978-98312000 GTGGAAAATACCCCTGTTCCTGG + Intergenic
958910256 3:99986272-99986294 CATGAAAAAACACCTGTTCCTGG - Intronic
959631684 3:108514197-108514219 CTGGGAAATACCTCAGTTCCGGG - Intronic
962361197 3:134744165-134744187 CTGGACAATACACCTCCTCCCGG - Intronic
968861442 4:3174155-3174177 AAGGAAAATACCCATGTTCCAGG + Intronic
969252297 4:5976084-5976106 GTGGGAAAGGCCCCTGTTCCTGG - Intronic
973372404 4:49262333-49262355 CAGGAAAATACCACTATGCCGGG + Intergenic
973388595 4:49532808-49532830 CAGGAAAATACCACTATGCCGGG - Intergenic
979281452 4:118872759-118872781 CTGGATCATACCCCTTTTTCTGG + Intronic
985912982 5:2897502-2897524 CAGGAAAATCCCACTGTTGCTGG - Intergenic
989458169 5:41666389-41666411 CTGGAAAATAGCCATGTGGCTGG + Intergenic
1004109179 6:12698443-12698465 TTGCAAAATACCACTGTTTCAGG + Intergenic
1004110133 6:12709580-12709602 CTGGAAAAGAGCCTTTTTCCAGG + Intergenic
1004265436 6:14144962-14144984 GTGGAAAATGCCCCAATTCCAGG - Intergenic
1004785267 6:18961466-18961488 CAAGAAAATAGACCTGTTCCCGG + Intergenic
1009299135 6:61992765-61992787 CTGGAAAATACTTGTTTTCCAGG - Intronic
1012970947 6:105729982-105730004 CTGGAAAATATCCCTTTTCTGGG - Intergenic
1014683168 6:124459268-124459290 CCGCAAAATAAGCCTGTTCCTGG + Intronic
1018040543 6:159918047-159918069 CAGGGAAATACCCTTGTTCTTGG - Intergenic
1021072598 7:16260267-16260289 CTGGAAAATAAATCTGTTCTAGG - Intronic
1023255367 7:38307413-38307435 TTGGAAAAAAACCCTGTTCCAGG - Intergenic
1026541204 7:71281409-71281431 CAGGAAAATAGCCCATTTCCTGG + Intronic
1027787613 7:82599646-82599668 CAGTAAAAGACACCTGTTCCGGG - Intergenic
1030271129 7:107669376-107669398 CTGAAAAGTTCCCCTTTTCCAGG + Intronic
1031725759 7:125236061-125236083 ATGGAAAATACTTCTGTTACAGG + Intergenic
1031963612 7:128011304-128011326 CTGGTAACTACCCTGGTTCCTGG + Intronic
1034539884 7:151750736-151750758 CAGGAACATACCACTGTGCCTGG - Intronic
1034706361 7:153149147-153149169 CTGGAAGATATTCCTTTTCCTGG - Intergenic
1036622553 8:10434381-10434403 CTGGAAAATGTCCCTCTCCCTGG - Intergenic
1040879000 8:52183907-52183929 CTGGAAAATACCCACGGCCCAGG + Intronic
1042436387 8:68770981-68771003 CTGGAAATGACCCCTTTTACTGG - Intronic
1042668382 8:71232633-71232655 GTGGCAAATGCCCCTGCTCCAGG - Intronic
1042758698 8:72247122-72247144 CTGGAAAATATCACTGGTCGGGG + Intergenic
1044848627 8:96406475-96406497 CTGGAAAATCCTCCTCTTACTGG - Intergenic
1045478258 8:102571815-102571837 GTGGAACATACCCCGGTTACTGG + Intergenic
1046083669 8:109404236-109404258 TTGAAAAATAACCCTGTCCCTGG - Intronic
1047201873 8:122774037-122774059 CTGGAGAAAACCCCTCCTCCTGG + Intergenic
1048006307 8:130422094-130422116 CTGGAGTATTCCCCTCTTCCAGG - Intronic
1048251047 8:132866994-132867016 CAGGAAAATGGCCCTGGTCCTGG + Exonic
1048304568 8:133274750-133274772 CTTGAGTATAGCCCTGTTCCTGG - Intronic
1049032552 8:140048444-140048466 CTGGACAATAGCCCTATGCCAGG + Intronic
1049570088 8:143365630-143365652 CTGGAAAATCTGCATGTTCCTGG + Intergenic
1054980777 9:71203291-71203313 CTGGAAAATATCCCTTTCACAGG + Intronic
1056710633 9:88990122-88990144 CTGGGAAGTACCCCAGCTCCCGG + Intergenic
1059159472 9:112020291-112020313 CTGGAAAATACCCCAATTCAAGG - Intergenic
1203553099 Un_KI270743v1:180664-180686 CAGGAAAATACCACTATGCCGGG - Intergenic
1187449434 X:19383567-19383589 TTGCAAAATACCCCTCTGCCAGG + Intronic
1188962445 X:36508630-36508652 CTGCATTATGCCCCTGTTCCAGG - Intergenic
1198313078 X:135438727-135438749 CTGGAGAATGGCCCTGTGCCCGG + Intergenic
1200100104 X:153685970-153685992 CTGGAGAAGAGCCCAGTTCCAGG + Intronic
1200779189 Y:7199017-7199039 TTGGAAAATACCTCTTTTACCGG + Intergenic
1202109634 Y:21406388-21406410 CATGGAAATACCCCTGCTCCCGG + Intergenic