ID: 958754741

View in Genome Browser
Species Human (GRCh38)
Location 3:98237516-98237538
Sequence ATGCATATCAATCACCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958754736_958754741 21 Left 958754736 3:98237472-98237494 CCATCTCTTCCAATATCATATCA No data
Right 958754741 3:98237516-98237538 ATGCATATCAATCACCTTGAGGG No data
958754739_958754741 12 Left 958754739 3:98237481-98237503 CCAATATCATATCACACAGGGAC No data
Right 958754741 3:98237516-98237538 ATGCATATCAATCACCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958754741 Original CRISPR ATGCATATCAATCACCTTGA GGG Intergenic
No off target data available for this crispr