ID: 958757277

View in Genome Browser
Species Human (GRCh38)
Location 3:98264641-98264663
Sequence CTGTGGTTACAGTGGTTACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958757277_958757281 1 Left 958757277 3:98264641-98264663 CCTTGTAACCACTGTAACCACAG 0: 1
1: 0
2: 0
3: 19
4: 185
Right 958757281 3:98264665-98264687 ATGTTTTCTCTTGGCAACAATGG 0: 6
1: 3
2: 5
3: 34
4: 237
958757277_958757279 -8 Left 958757277 3:98264641-98264663 CCTTGTAACCACTGTAACCACAG 0: 1
1: 0
2: 0
3: 19
4: 185
Right 958757279 3:98264656-98264678 AACCACAGAATGTTTTCTCTTGG 0: 3
1: 10
2: 3
3: 30
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958757277 Original CRISPR CTGTGGTTACAGTGGTTACA AGG (reversed) Exonic
901111859 1:6803676-6803698 CAGTGGTTTCAGTAGTTACAGGG + Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
905749044 1:40445719-40445741 ATGTGGTTACACTGGTGAGAAGG - Intergenic
905804585 1:40866553-40866575 ATGACGTTACAGTGGCTACAAGG - Intergenic
906650047 1:47506623-47506645 TTGTGGAGACACTGGTTACATGG - Intergenic
906877997 1:49558819-49558841 CTGTGGTGGCAGTGGCTACTGGG + Intronic
907734048 1:57094493-57094515 CTGAGGTCAGAGTGGTTACAGGG + Intronic
907918990 1:58895730-58895752 ATGTGGGTACAGAGATTACAAGG - Intergenic
908617580 1:65939393-65939415 CTGTGGTAACCTTGGCTACATGG - Intronic
911683406 1:100745532-100745554 CTTTGGTTACAGTGACTAGAAGG + Intergenic
912574026 1:110648105-110648127 CTGTGAATACAGAGATTACAAGG + Intergenic
912615620 1:111097025-111097047 CTGTGGTGACAGCAGCTACAAGG - Intergenic
914415954 1:147482378-147482400 CTGTTATTACAGTGGCTACCAGG - Intergenic
915941588 1:160121611-160121633 CTGTGGTTACAGTGATTTGCTGG + Intronic
920030344 1:203033973-203033995 CTGTGCTGACAGTCGTTCCAGGG - Intronic
920950192 1:210565312-210565334 CTGTGGTGACATTTGTTTCAGGG - Intronic
922045859 1:221945852-221945874 CTGGGGTGGCACTGGTTACAGGG - Intergenic
923038174 1:230300232-230300254 CTGTGTTTACAGCGGAGACACGG - Intergenic
923121997 1:231000835-231000857 CTGTGGTTACAGGGGTGAATAGG + Intergenic
923273807 1:232379791-232379813 GTGCTGTTGCAGTGGTTACATGG - Intergenic
1068319532 10:55393478-55393500 CTCAGTTTACAGTTGTTACATGG - Intronic
1068828592 10:61467886-61467908 CTGTTGTTACTGTTGTTAGAAGG - Intergenic
1070273071 10:74976665-74976687 CTGTGGCTGCAGAGGTGACATGG - Intronic
1071495912 10:86167520-86167542 CTGTGGGGACAGTGGTTGCTGGG + Intronic
1071961788 10:90814340-90814362 CTGTGGTTATAGGGGCTAAAGGG + Intronic
1072010639 10:91299981-91300003 CTGTGTTTGCAGTGGTGACAGGG + Intergenic
1072569008 10:96642348-96642370 CTGGGGAGGCAGTGGTTACAGGG + Intronic
1073074174 10:100813174-100813196 CTGTGGGTGCAGTGGCTCCAGGG - Intronic
1074678467 10:115879762-115879784 CTGTGGTTCGAGTGGCTGCAAGG + Intronic
1076763355 10:132616606-132616628 TTGGGGTTGCAGTGGTGACATGG + Intronic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077852025 11:6082397-6082419 CTGTGGTCACAGAGAATACAAGG + Intergenic
1078011498 11:7576281-7576303 CGGTGGGAACTGTGGTTACACGG - Intronic
1085978222 11:81687142-81687164 CTGTGATTACAATGGTGTCATGG + Intergenic
1086931914 11:92702893-92702915 CTGTCTTTACACTGGTTACTGGG - Intronic
1087266148 11:96063379-96063401 CTGTGGGTACAGTGCTAAAAAGG - Intronic
1087538189 11:99479461-99479483 CTGCATTTACAGTGTTTACAAGG - Intronic
1088899204 11:114102473-114102495 CAGTGGTAACAGTGGTTAGAGGG + Intronic
1088954957 11:114608685-114608707 ACCTGGTTACAGTGGTTACCTGG - Intergenic
1088955653 11:114613100-114613122 ACCTGGTTACAGTGGTTACCTGG - Intergenic
1089578818 11:119468728-119468750 CTGGGGTGGCAGTGGTTACGGGG - Intergenic
1091636438 12:2200569-2200591 CTGAGGATACGGTGGTGACAGGG + Intronic
1093877037 12:24361040-24361062 CTGTGGTTACAGTGAAAGCAAGG + Intergenic
1093909710 12:24732434-24732456 CTGTAGTTACATTGATTATAGGG - Intergenic
1094170100 12:27482156-27482178 CAGTGGAAACAGTGCTTACAGGG - Intronic
1096045370 12:48557583-48557605 CTTTGGTTACTGAAGTTACAAGG + Intergenic
1096432459 12:51558075-51558097 CTGAGATTACAGTGTTTACCTGG + Intergenic
1097405597 12:59185551-59185573 CGGTGGTTGCAGTGGTTGCCAGG + Intergenic
1098661125 12:73095008-73095030 ATGATGTTACAGTGGCTACAGGG - Intergenic
1100258467 12:92908301-92908323 TTGTGGTTACAGTGGGTTCAGGG + Intronic
1102785597 12:115601750-115601772 CTGTGGTTTCACTGGTAACAAGG - Intergenic
1102802258 12:115746328-115746350 CAGTTGTTACAGAGGTTTCAAGG - Intergenic
1103182353 12:118924696-118924718 CTGTGGATACAGTGGTGCAAAGG + Intergenic
1103287908 12:119818147-119818169 ATGTGGTTACTGTGGTAACTTGG - Intronic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1106645468 13:31629566-31629588 CTGGGGTGGCAGTGGCTACAGGG - Intergenic
1107160036 13:37215075-37215097 GTGTGGTTACAGGGATTACGGGG + Intergenic
1108002670 13:45918944-45918966 CTAAGGTTACACTGGTCACATGG + Intergenic
1110282011 13:73704807-73704829 CTGGGGATACAGTGGTAAGAAGG - Intronic
1110324280 13:74195975-74195997 ATGTATTTACTGTGGTTACAAGG + Intergenic
1111667441 13:91286968-91286990 TTCTGCTTACATTGGTTACAAGG + Intergenic
1117580210 14:57144108-57144130 CTGTCGATCCAGTGGTTTCAGGG + Intergenic
1118007898 14:61581643-61581665 CTGAGGCCACAGGGGTTACAGGG + Intronic
1126296933 15:47149838-47149860 CAGTGGTTGCTGTAGTTACAGGG + Intergenic
1126771317 15:52059233-52059255 ATGTTGTGACAGTGGCTACAGGG - Intronic
1131612488 15:93979654-93979676 CTTTGTTTAAAGTGGTCACAAGG + Intergenic
1133480193 16:6162596-6162618 CAGTGGTAACAGTGTTTCCAAGG + Intronic
1134592165 16:15463414-15463436 CTGTGATAACAGTGGTTCAAAGG - Intronic
1135726467 16:24857677-24857699 CTGTTTTTACTGTGATTACATGG + Intronic
1135879600 16:26241052-26241074 CTGTGGTGGCAGTGGCTACGGGG + Intergenic
1139945697 16:70640353-70640375 CTGTGATTACAGTTGACACAAGG - Intronic
1140726542 16:77818433-77818455 CTTTGGTTACACTGCTTACCTGG - Intronic
1141485204 16:84334211-84334233 CAGTGGTGACAGTGGCCACAGGG + Intergenic
1141922518 16:87145594-87145616 CTGTGGTGTCATTTGTTACATGG - Intronic
1144544890 17:16185052-16185074 CAGTGCTAACAGTGGTTACCAGG + Intronic
1146271730 17:31489320-31489342 AGGTGGTTACAGTGGTTGCTGGG + Intronic
1148696913 17:49566096-49566118 CTGGGGTTACAGTGGTGGGAGGG + Intergenic
1156334117 18:36152912-36152934 CTTTGGTTTCAGTAGTTACTTGG + Intronic
1158021872 18:52852695-52852717 ATGTAGTTACAGTGCTTAGATGG + Intronic
1158709552 18:59825147-59825169 CTGTGGTGGCAGTGGCCACAGGG - Intergenic
1159435709 18:68414402-68414424 CTGTAGTGACAGAGGTAACAAGG + Intergenic
1160171499 18:76559156-76559178 CTGTGGTGACAGAGGTTTAACGG - Intergenic
1160710935 19:550685-550707 CTGGGGTGACAGTGGGGACAGGG - Intergenic
1160711000 19:550897-550919 CTGGGGTGACAGTGGGGACAGGG - Intergenic
1161998530 19:7729490-7729512 CCCTGGTTCCAGTGGCTACAGGG + Exonic
1163184016 19:15623780-15623802 CTGGGGCTACAGTGGGGACAGGG + Intronic
1164131952 19:22371486-22371508 CTGTGTTTAAAGTGATTACTAGG - Intergenic
1166931791 19:46305436-46305458 CTGGGGATACAGTGGTGACCAGG + Intronic
926072889 2:9914514-9914536 CTGGGGTCTCAGTGGTGACAGGG + Intronic
926308576 2:11658152-11658174 CTGTTGTTACTGTTGTTGCATGG - Intergenic
929049903 2:37827635-37827657 CTGTCGTTAAATTGCTTACACGG + Intergenic
930726604 2:54687698-54687720 CTGGGGCTGCAGTGGTGACAAGG + Intergenic
931944046 2:67285333-67285355 CTGTGGGCACAGTGGTTCCTAGG + Intergenic
932194936 2:69775111-69775133 CTGTGGTTTCAATCGTTTCATGG + Intronic
933359667 2:81264839-81264861 CTATGGAGACAGTGGTTACCAGG - Intergenic
935694595 2:105760550-105760572 CTGTGGGAGAAGTGGTTACACGG - Intronic
937290343 2:120778100-120778122 CTCTGTTTACAGTGGGTACTGGG - Intronic
940774782 2:157875186-157875208 ATGTGGTTACAGATGTTGCACGG - Intronic
941672528 2:168310370-168310392 CTGTGGTGGCAGTGGCCACAGGG - Intergenic
942539181 2:176997524-176997546 CTGTGTTGACAGTGGGGACAAGG + Intergenic
942644807 2:178098390-178098412 CTGTGGTAATTATGGTTACATGG + Intronic
944308332 2:198203205-198203227 CTGTAGTTTCAGTGGATACTGGG - Intronic
945180949 2:207090558-207090580 CTGTGTTCACAGAGGTTACTAGG + Intronic
947825236 2:233101223-233101245 CTGTGGTTAGAGTGTCTCCACGG - Intronic
1169519527 20:6356150-6356172 CTGTGGTCACAGAGCTCACAGGG + Intergenic
1170495591 20:16921399-16921421 CTGAGGATACAGTGGTTCTATGG + Intergenic
1170798827 20:19573315-19573337 CTTTGTCTACAGTGGTTAAATGG - Intronic
1172902727 20:38346692-38346714 CTCTGGGTACAGTGGGGACAGGG + Intronic
1177292008 21:19125738-19125760 GTGTGGTTAGAGAGGTTAAAAGG + Intergenic
1180987373 22:19912832-19912854 CTGTGCTTACTGTGGAAACAGGG - Intronic
1181318956 22:21990158-21990180 CTCTGGTTCCAGGGTTTACATGG + Intergenic
1185236630 22:49717314-49717336 CTGTGTAAACAGTTGTTACACGG + Intergenic
950494360 3:13324726-13324748 CTGTGTTTGCAGAGGTTACCTGG - Intronic
951245023 3:20330937-20330959 CTTTGGTTACAGTGGTTGTTTGG + Intergenic
951563705 3:23991902-23991924 CTGTGGTTTCTGTGTTTACCAGG + Intergenic
951626586 3:24671267-24671289 CTGTGGTTATAGTGGTGAGTAGG + Intergenic
954491660 3:50912708-50912730 CTGTGGCAGCAGTGGCTACAGGG - Intronic
954977776 3:54712850-54712872 CTGTGGTTGCATTGGTCCCATGG + Intronic
955844801 3:63151098-63151120 CTGTGGTTACCAGGGTAACATGG - Intergenic
956142097 3:66156273-66156295 CTGGGGTTACAGCAGTAACAAGG + Intronic
956463994 3:69500657-69500679 CTGTGGTTCCAGTTCTTACCAGG - Intronic
958753546 3:98222359-98222381 CTGTGGTTACACTGATTGCAAGG - Intergenic
958757277 3:98264641-98264663 CTGTGGTTACAGTGGTTACAAGG - Exonic
958761508 3:98314467-98314489 ATCTGGCTACAGTGCTTACAAGG - Intergenic
958876733 3:99625080-99625102 CTGTGGTGGCAGTGGCCACAGGG + Intergenic
961952354 3:130762854-130762876 CTGTGGTGGTAGTGGCTACAGGG + Intergenic
962077288 3:132095957-132095979 CTGTGGTCACAGTTTCTACAAGG - Intronic
962898693 3:139738014-139738036 CTGTGGTAACAGAGGACACAGGG + Intergenic
962972611 3:140418215-140418237 ATGTGGTTATAGTTGTCACAGGG - Intronic
964318173 3:155465860-155465882 CTGGGGTGGCAGTGGCTACAAGG + Intronic
965350961 3:167610417-167610439 CTGGGGTAGCAGTGGCTACAGGG + Intronic
965415134 3:168384136-168384158 CTGTGGTGATAGTGGCCACAGGG - Intergenic
965561662 3:170067619-170067641 CTGTGATTGCAGAGGTCACATGG - Intronic
969135995 4:5029242-5029264 CTGTGGTTAGGTTAGTTACATGG + Intergenic
971144004 4:23956831-23956853 CTATGGTTACAATGATTATAAGG - Intergenic
974943547 4:68497947-68497969 CTGTGTTTACAGTTCATACATGG + Intergenic
975032780 4:69642820-69642842 TTGTTTTTACAGTGGTTAAAGGG + Intronic
976634334 4:87272754-87272776 CTGTGGATACAGTGGTAAATAGG + Intergenic
977409475 4:96643276-96643298 CTGTGGTTACACTGACTATATGG + Intergenic
978570780 4:110134647-110134669 ATGTGTTTACAGTGTTTAAAAGG + Intronic
979133801 4:117083478-117083500 CTGTGGTTACTGATCTTACAAGG + Intergenic
979425631 4:120561834-120561856 ATGTGGTTACACTGGTAAGAAGG - Intergenic
979848867 4:125551801-125551823 CTGTGGTGACAGTGGAAATAAGG + Intergenic
982203281 4:152978233-152978255 CTGTGTTCACTCTGGTTACAGGG + Exonic
982961871 4:161849296-161849318 CTGTGGTATCAGTTGGTACAAGG + Intronic
983507940 4:168575544-168575566 CTGGGGTTAGAGTGGTGATATGG - Intronic
984221729 4:176986326-176986348 CTTAGGTAACAGTGGGTACATGG + Intergenic
984524374 4:180840459-180840481 CTGAGGTTTCAGTGGATAAAGGG - Intergenic
986219402 5:5754058-5754080 CTGTGGTTTCAGTGTTCACTGGG + Intergenic
987214864 5:15724419-15724441 TTGTGGTGGCGGTGGTTACAGGG - Intronic
987823156 5:22991742-22991764 CTGTGGTGATGGTGGCTACAGGG + Intergenic
989186729 5:38633151-38633173 CTTTGGTTTCAGTAGTTACCTGG - Intergenic
992335338 5:75761828-75761850 CTGTAGTTACAGAGGTAATAGGG - Intergenic
996800694 5:127399596-127399618 CTGTTCTTTCAGAGGTTACAAGG + Intronic
998501191 5:142634256-142634278 ATGTGGTCACAGTGGATAAAAGG - Intronic
999738880 5:154534227-154534249 CTGAGGTCAGAGTGGTGACAGGG + Intergenic
1002768780 6:269154-269176 CTGTGGTTATAGTGTTTTCTGGG + Intergenic
1003018819 6:2492266-2492288 GAGTGGATACAGTGGGTACAGGG - Intergenic
1003144084 6:3495132-3495154 CACTGGCTACACTGGTTACAAGG - Intergenic
1003627733 6:7758618-7758640 CTGTGGTGGCAGTGGCTAAAGGG + Intronic
1004349403 6:14878112-14878134 CTGTGGACACAGTGGCTACATGG - Intergenic
1004540547 6:16545471-16545493 TTGTGGTTCCAGTGATTACCAGG - Intronic
1004870766 6:19901731-19901753 CTGTGGTAACTGTGGTGCCAGGG - Intergenic
1005010582 6:21331800-21331822 CTGTGTTTAAGGTGGGTACAGGG - Intergenic
1011239328 6:85254764-85254786 CTGTGGTCACACTGTTTCCAGGG - Intergenic
1011394449 6:86891573-86891595 CTGTGGTTGCTGTCTTTACAGGG + Intergenic
1014160533 6:118162839-118162861 CAGTGCTTACAGTGCTTACAGGG + Intronic
1018423862 6:163662979-163663001 CTCTGGTTGCAGGGGTGACATGG + Intergenic
1018443267 6:163832976-163832998 CTGTGATTACAGTGGCCACCTGG + Intergenic
1020981648 7:15076918-15076940 CTATGGTTACATTAGATACATGG - Intergenic
1021283807 7:18754059-18754081 ATTAGATTACAGTGGTTACATGG + Intronic
1027692231 7:81362149-81362171 CTGTGGTCACAGTAGAGACAGGG + Intergenic
1037210327 8:16378229-16378251 CTCTGGTTGCAGTGATAACATGG - Intronic
1038092342 8:24268408-24268430 GTGTGGTCACTGTGGATACAGGG + Intergenic
1038640998 8:29326849-29326871 CAGTGTTAACAGTGTTTACACGG + Intergenic
1038858780 8:31362380-31362402 CTGGGCCTACAGTAGTTACATGG + Intergenic
1038871841 8:31503778-31503800 CTGGGGTGGCAGTGGCTACAGGG - Intergenic
1039713495 8:40083479-40083501 CTGTGTTTACAGTGGAGAGAGGG - Intergenic
1045995858 8:108360664-108360686 TTGTGGTTACCGTGATTAAAAGG + Intronic
1050567652 9:6902731-6902753 CTGTGGGGACAGTGTTTGCAGGG + Intronic
1050877375 9:10655408-10655430 CTGTGGTTAAATTTGTTCCAAGG - Intergenic
1055073811 9:72193908-72193930 CTGTGGTGGCAGTGGACACAAGG - Intronic
1057197787 9:93124678-93124700 CTGTGGTCACAGTGTTTAGATGG - Intronic
1058577616 9:106420716-106420738 CTGTGTGTACAGTGGTGATAGGG - Intergenic
1059492516 9:114680748-114680770 TCGTTGTTACCGTGGTTACAGGG - Intergenic
1060682020 9:125574752-125574774 CTGCGGTTACAGTAGTTAGGAGG + Intronic
1186591698 X:10936931-10936953 ATGTGGCCCCAGTGGTTACAGGG - Intergenic
1187657764 X:21497819-21497841 CTGTGGTTCCAGTAATTACATGG - Exonic
1187871791 X:23770832-23770854 TTGTGTTTATAGTGGTTACAGGG + Intergenic
1190430907 X:50377015-50377037 ATGTGGGTACAGTGGGTAGAGGG + Intronic
1191924500 X:66295384-66295406 CTGGGGTTGCAGTAGCTACAGGG - Intergenic
1193573844 X:83176215-83176237 CTGTGGATCCAGTGGGTACCTGG - Intergenic
1194033200 X:88840597-88840619 ATGTGGTTGCAGTGGCCACAGGG + Intergenic
1194265009 X:91743133-91743155 CTGAGGTGGCAGTGGTTACAGGG - Intergenic
1195492400 X:105486606-105486628 TTGTGGTTCCAGGGGTTACATGG + Intronic
1195671534 X:107474155-107474177 CTGAGGTTCCCGTGGTAACAGGG - Intergenic
1196579131 X:117359044-117359066 CTGTGGTGGCAGTGGCTACAGGG - Intergenic
1196660574 X:118264580-118264602 CTGTGGTGGCAGTGGCTACAAGG + Intergenic
1197096729 X:122604859-122604881 CTGGGGTGGCAGTGGCTACATGG + Intergenic
1197573651 X:128180619-128180641 CTGTGTTTACATTAGTTTCAAGG - Intergenic
1197600419 X:128520642-128520664 CTGTGGTGGCAGTGGCCACAAGG + Intergenic
1199050628 X:143232657-143232679 CTGTAGTGGCAGTGGCTACAGGG + Intergenic
1199217883 X:145282078-145282100 CTGTGGTGGCAGTGGCCACAAGG - Intergenic
1199439598 X:147853873-147853895 CTGGGGTGGCAGTGGCTACAGGG - Intergenic
1200582159 Y:4963579-4963601 CTGAGGTGGCAGTGGTTACAGGG - Intergenic