ID: 958762489

View in Genome Browser
Species Human (GRCh38)
Location 3:98326098-98326120
Sequence AAGTGATCAGAGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958762489_958762492 -3 Left 958762489 3:98326098-98326120 CCCTCCTGCTTCTCTGATCACTT No data
Right 958762492 3:98326118-98326140 CTTCCTTCAGTATCTTTTTCTGG No data
958762489_958762494 30 Left 958762489 3:98326098-98326120 CCCTCCTGCTTCTCTGATCACTT No data
Right 958762494 3:98326151-98326173 GTCTCTCTTTTGTTTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958762489 Original CRISPR AAGTGATCAGAGAAGCAGGA GGG (reversed) Intergenic