ID: 958762490 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:98326099-98326121 |
Sequence | GAAGTGATCAGAGAAGCAGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
958762490_958762494 | 29 | Left | 958762490 | 3:98326099-98326121 | CCTCCTGCTTCTCTGATCACTTC | No data | ||
Right | 958762494 | 3:98326151-98326173 | GTCTCTCTTTTGTTTGAGCCAGG | No data | ||||
958762490_958762492 | -4 | Left | 958762490 | 3:98326099-98326121 | CCTCCTGCTTCTCTGATCACTTC | No data | ||
Right | 958762492 | 3:98326118-98326140 | CTTCCTTCAGTATCTTTTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
958762490 | Original CRISPR | GAAGTGATCAGAGAAGCAGG AGG (reversed) | Intergenic | ||