ID: 958762491

View in Genome Browser
Species Human (GRCh38)
Location 3:98326102-98326124
Sequence AAGGAAGTGATCAGAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958762491_958762494 26 Left 958762491 3:98326102-98326124 CCTGCTTCTCTGATCACTTCCTT No data
Right 958762494 3:98326151-98326173 GTCTCTCTTTTGTTTGAGCCAGG No data
958762491_958762492 -7 Left 958762491 3:98326102-98326124 CCTGCTTCTCTGATCACTTCCTT No data
Right 958762492 3:98326118-98326140 CTTCCTTCAGTATCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958762491 Original CRISPR AAGGAAGTGATCAGAGAAGC AGG (reversed) Intergenic