ID: 958762493

View in Genome Browser
Species Human (GRCh38)
Location 3:98326121-98326143
Sequence AGACCAGAAAAAGATACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958762493_958762494 7 Left 958762493 3:98326121-98326143 CCTTCAGTATCTTTTTCTGGTCT No data
Right 958762494 3:98326151-98326173 GTCTCTCTTTTGTTTGAGCCAGG No data
958762493_958762496 25 Left 958762493 3:98326121-98326143 CCTTCAGTATCTTTTTCTGGTCT No data
Right 958762496 3:98326169-98326191 CCAGGATTCTCAGTTACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958762493 Original CRISPR AGACCAGAAAAAGATACTGA AGG (reversed) Intergenic