ID: 958762494

View in Genome Browser
Species Human (GRCh38)
Location 3:98326151-98326173
Sequence GTCTCTCTTTTGTTTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958762490_958762494 29 Left 958762490 3:98326099-98326121 CCTCCTGCTTCTCTGATCACTTC No data
Right 958762494 3:98326151-98326173 GTCTCTCTTTTGTTTGAGCCAGG No data
958762493_958762494 7 Left 958762493 3:98326121-98326143 CCTTCAGTATCTTTTTCTGGTCT No data
Right 958762494 3:98326151-98326173 GTCTCTCTTTTGTTTGAGCCAGG No data
958762489_958762494 30 Left 958762489 3:98326098-98326120 CCCTCCTGCTTCTCTGATCACTT No data
Right 958762494 3:98326151-98326173 GTCTCTCTTTTGTTTGAGCCAGG No data
958762491_958762494 26 Left 958762491 3:98326102-98326124 CCTGCTTCTCTGATCACTTCCTT No data
Right 958762494 3:98326151-98326173 GTCTCTCTTTTGTTTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958762494 Original CRISPR GTCTCTCTTTTGTTTGAGCC AGG Intergenic