ID: 958768056

View in Genome Browser
Species Human (GRCh38)
Location 3:98394937-98394959
Sequence CAGGATACACATCCCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958768046_958768056 25 Left 958768046 3:98394889-98394911 CCAAAAAACTCTAAGTCCCCAAA No data
Right 958768056 3:98394937-98394959 CAGGATACACATCCCCATCAGGG No data
958768051_958768056 8 Left 958768051 3:98394906-98394928 CCCAAAGTGTGAGAAGGGGACAG No data
Right 958768056 3:98394937-98394959 CAGGATACACATCCCCATCAGGG No data
958768050_958768056 9 Left 958768050 3:98394905-98394927 CCCCAAAGTGTGAGAAGGGGACA No data
Right 958768056 3:98394937-98394959 CAGGATACACATCCCCATCAGGG No data
958768052_958768056 7 Left 958768052 3:98394907-98394929 CCAAAGTGTGAGAAGGGGACAGA No data
Right 958768056 3:98394937-98394959 CAGGATACACATCCCCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958768056 Original CRISPR CAGGATACACATCCCCATCA GGG Intergenic
No off target data available for this crispr