ID: 958773563

View in Genome Browser
Species Human (GRCh38)
Location 3:98455001-98455023
Sequence CTTTATTTCTGGAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958773563_958773570 28 Left 958773563 3:98455001-98455023 CCATGTTCCCTCCAGAAATAAAG No data
Right 958773570 3:98455052-98455074 TCACTCACTCTACCCTTCCCTGG No data
958773563_958773567 -8 Left 958773563 3:98455001-98455023 CCATGTTCCCTCCAGAAATAAAG No data
Right 958773567 3:98455016-98455038 AAATAAAGCCTTTATTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958773563 Original CRISPR CTTTATTTCTGGAGGGAACA TGG (reversed) Intergenic
No off target data available for this crispr