ID: 958781110

View in Genome Browser
Species Human (GRCh38)
Location 3:98543440-98543462
Sequence ACTGAAGAGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 620}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958781110_958781117 18 Left 958781110 3:98543440-98543462 CCTTCCACCTTCTGCTCTTCAGT 0: 1
1: 0
2: 4
3: 42
4: 620
Right 958781117 3:98543481-98543503 AGATACCAGCACCATGCTCTTGG 0: 4
1: 44
2: 89
3: 273
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958781110 Original CRISPR ACTGAAGAGCAGAAGGTGGA AGG (reversed) Intronic
900426881 1:2585009-2585031 GATGCAGAGCAGAAGGTGGCTGG - Intergenic
900687591 1:3958528-3958550 AATGAATAGCACAGGGTGGAAGG - Intergenic
900732583 1:4271949-4271971 ACTGCAGTTGAGAAGGTGGAAGG - Intergenic
900742873 1:4341359-4341381 ACTGAAGATGGAAAGGTGGAAGG + Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
901024817 1:6273620-6273642 ACTGGAGTGCAGAAGGTTGACGG - Intronic
901545590 1:9954290-9954312 ACTAAAGCCCAGGAGGTGGAGGG - Intronic
901631374 1:10649790-10649812 AAAGAAGCGCAGAAGGAGGAGGG + Intronic
901757829 1:11452079-11452101 ACTGTAGAGCAGAAGCAGGCTGG + Intergenic
901977697 1:13008436-13008458 ACTGGAGAGTGGAGGGTGGAAGG - Intronic
902004388 1:13220499-13220521 ACTGGAGAGTGGAGGGTGGAAGG + Intergenic
902023611 1:13366237-13366259 ACTGGAGAGTGGAGGGTGGAAGG + Intergenic
902228734 1:15013815-15013837 ACTGAGGAGCTGAAGGAGGCAGG + Intronic
902592592 1:17485684-17485706 AATGGAGAGAAGAAGATGGATGG + Intergenic
902687823 1:18090400-18090422 ACTCAAGAGCCTGAGGTGGAAGG - Intergenic
902744469 1:18464224-18464246 GCTGAAGATCAGCAGGTGGCTGG - Intergenic
903075535 1:20762009-20762031 ACTAAAGTGGAGAAAGTGGAAGG + Intronic
903084548 1:20843801-20843823 ACTGGAGGACAGAAGGTGGAAGG - Intronic
904342382 1:29845292-29845314 ACAGGAGAGCAGAAGGTGTTGGG + Intergenic
904480250 1:30788842-30788864 TGTGCAGAGCAGAAGGAGGAGGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905264303 1:36740384-36740406 CCTGGAGAGCAAGAGGTGGATGG + Intergenic
905393199 1:37651154-37651176 ATTGTGGAGCAGCAGGTGGAAGG - Intergenic
906192684 1:43908156-43908178 ACTGAAGAGTCGAATATGGAAGG - Intronic
906690086 1:47786806-47786828 ACTCAAGAGGCTAAGGTGGAAGG - Intronic
906938928 1:50238699-50238721 ACTGGAGAGCAAAAGGGGAAAGG - Intergenic
907104968 1:51874498-51874520 ACTGGAGAGCCTGAGGTGGAAGG + Intronic
907363368 1:53939503-53939525 AATGAAGAGTAGAAATTGGAAGG + Intronic
907705353 1:56827846-56827868 CCTGAAGAGCAGAAGGATAATGG + Intergenic
909025758 1:70480022-70480044 ATTGAAGAAAAGAAGGAGGAAGG - Intergenic
909099781 1:71336210-71336232 ACTGAGGGGCAGAAGTTAGAAGG + Intergenic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
909431974 1:75598770-75598792 ATTGAAGAGTGGAAGGTGGGAGG + Intronic
909772051 1:79436035-79436057 ACTGAAGAGAAGAGGGTGTGGGG + Intergenic
909830346 1:80181432-80181454 ATTGAAAATCAGAAGGTGAAGGG - Intergenic
910633336 1:89380027-89380049 ACTAAAGAGGCTAAGGTGGAAGG + Intronic
910734351 1:90435837-90435859 ACTGAATAGCAGAAGCAAGAAGG + Intergenic
911295238 1:96106845-96106867 ACTGGAGAGGCTAAGGTGGAAGG + Intergenic
911793844 1:102052905-102052927 ATTGAAGAGCAGAAGGGATATGG + Intergenic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
912187257 1:107292971-107292993 TCTGAAGGGCATAAGGCGGAAGG - Intronic
913082276 1:115399726-115399748 ACTGCAGAGGAGAAGAGGGAGGG - Intergenic
913320980 1:117588235-117588257 AGTGTTGAGCAGGAGGTGGATGG - Intergenic
914261352 1:146001918-146001940 ACTCAAGAGGCCAAGGTGGAAGG - Intergenic
914446485 1:147754897-147754919 ACTAAAGAGCATAAGCTGGTTGG - Intergenic
915587876 1:156854128-156854150 ACGGAAGAGCAGCAGGTAGTCGG + Exonic
916004974 1:160651875-160651897 ACTCAAGAGAATAAGGAGGAAGG + Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920086550 1:203421655-203421677 ACTGGAGAGCAGTAGGTGTTGGG + Intergenic
920744240 1:208611036-208611058 ACTCAGGAGGATAAGGTGGAAGG - Intergenic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921515188 1:216081970-216081992 AATGAATAGAGGAAGGTGGAGGG + Intronic
922010106 1:221574986-221575008 ACAGAATTGAAGAAGGTGGAAGG - Intergenic
922209497 1:223476717-223476739 AGAGAAGAGGAGAAGGAGGAGGG + Intergenic
922546765 1:226463926-226463948 ACTGGGGAGCAGATGGTAGAAGG + Intergenic
922608890 1:226909618-226909640 ACTCAAGAGGCTAAGGTGGAAGG - Intronic
922663446 1:227449452-227449474 ACTGACGGGCAGAAGGCAGAAGG + Intergenic
922779225 1:228238117-228238139 AAAGGAGAGCAGCAGGTGGATGG - Intronic
923291013 1:232546237-232546259 AGAGAAGAGAAGAAGGTGAAGGG - Intronic
924003928 1:239586038-239586060 ATGGAAGAGTAGAAAGTGGATGG - Intronic
924191340 1:241555974-241555996 ACTCAAGAGCCTGAGGTGGAAGG + Intronic
1062847936 10:722376-722398 AGTGAAGAGCAGGTGGAGGACGG - Intergenic
1063278255 10:4595512-4595534 ACTCAAGAGGCTAAGGTGGAAGG + Intergenic
1063498598 10:6532671-6532693 TCTCCAGAGCAGAAGGTAGATGG + Intronic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1063652479 10:7951815-7951837 ACTGAAGTTCAGAAGGATGAAGG + Intronic
1064064476 10:12169264-12169286 AGTGAAGTTAAGAAGGTGGAAGG + Intronic
1064811657 10:19206866-19206888 GCTGTAGGGCAGAAGGTGAATGG - Intronic
1064844115 10:19632307-19632329 ACTGGAGATTGGAAGGTGGAAGG - Intronic
1065625300 10:27623858-27623880 ACTCAAGAGGCTAAGGTGGAAGG - Intergenic
1065971847 10:30812012-30812034 ACCGGGGAGCAGAAGGTGGGGGG - Intergenic
1066084421 10:31962485-31962507 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1068651324 10:59526077-59526099 GCTGAACAGCAGGAGGTGAAAGG - Intergenic
1068705920 10:60075216-60075238 ACTTAAGGGCAGAGGGTGCAAGG + Exonic
1069683248 10:70300144-70300166 ACAGATGAGGAGAAGGTGGGAGG + Exonic
1070477223 10:76841310-76841332 ACTGCAGAGAAGAAGGGGAATGG - Intergenic
1071851237 10:89572574-89572596 ACTGAATAGCAGTAGGAGGAAGG + Intergenic
1072429932 10:95361839-95361861 ACTGAAGACCAGAATGTCAAAGG + Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074108817 10:110408427-110408449 ACTGAGGAGGGGAAGGGGGAGGG - Intergenic
1074783773 10:116821029-116821051 AATTTAGAGGAGAAGGTGGAGGG - Intergenic
1074784390 10:116826182-116826204 ACAGCAGAGATGAAGGTGGAGGG - Intergenic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1076272409 10:129165934-129165956 AAAGAAGAGAAGAAGGAGGAAGG + Intergenic
1076644660 10:131944666-131944688 ACTGGACAGCAGAGGGAGGACGG - Intronic
1077523596 11:3050695-3050717 AAAAAAGAGCAGCAGGTGGAGGG - Intronic
1077942821 11:6861748-6861770 ACTTGAGAGTGGAAGGTGGAAGG + Intergenic
1078002166 11:7505720-7505742 ACTCAGGAGGAGAAGGTGGGGGG + Intronic
1078075829 11:8159517-8159539 ACTGAAGTGGGGAAGGAGGAAGG + Intronic
1078422313 11:11222794-11222816 ACTTGAAACCAGAAGGTGGAGGG - Intergenic
1079007859 11:16804770-16804792 TCTGAAGAGCAGAATTTGGCTGG - Intronic
1079582409 11:22082170-22082192 ACTCAGGAGCCTAAGGTGGAAGG - Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1082821926 11:57549929-57549951 AATGAGGAGCAGAAGGTCAAAGG - Intronic
1082942726 11:58725608-58725630 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
1082943076 11:58728412-58728434 ACTGAGGGGCATAAGGTGGAAGG - Intronic
1083129476 11:60611003-60611025 ACTTAGGAGGGGAAGGTGGAAGG + Intergenic
1083138924 11:60705429-60705451 CCTGCAGAGCAAAAGGAGGAAGG - Intronic
1083732681 11:64661232-64661254 GCTGCAGGGCACAAGGTGGAGGG - Intronic
1084265910 11:68005002-68005024 CCTAAAGAGCAGTGGGTGGAGGG - Intergenic
1084365746 11:68696727-68696749 ACTAAATAGCAGAATGTAGAGGG + Intergenic
1085873468 11:80378749-80378771 ACTCAAGAGCCTGAGGTGGAAGG - Intergenic
1086203780 11:84234346-84234368 ACTGATGGGCAGAAGGCAGAAGG - Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1090675311 11:128987810-128987832 ACTGAAGAGATTAAGGTGCATGG + Intronic
1091137040 11:133201125-133201147 ACTTGAGAGTGGAAGGTGGAAGG + Intronic
1091178892 11:133585546-133585568 ACTGAAGAACACTAGATGGATGG - Intergenic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091714113 12:2764807-2764829 GCTAAAGAGCAGAAGGAAGAAGG + Intergenic
1091827696 12:3525334-3525356 GCTGAAGAGCAGGAGGGGGCTGG + Intronic
1092265809 12:6979628-6979650 ACTGAAGGTCAGAGGGTGAAGGG - Intronic
1092534079 12:9371096-9371118 ACTTGAGAGTAGAAGGTCGAAGG - Intergenic
1093088353 12:14891985-14892007 ACAAAAAAGCAGATGGTGGAGGG + Intronic
1093245906 12:16736281-16736303 ACTGCAGAGCAGTAGGTGAGTGG + Intergenic
1093682468 12:22018068-22018090 ACTGGAGAGGAAGAGGTGGAAGG + Intergenic
1093860689 12:24162911-24162933 ACTGAAGTGAAGAAGGCTGAGGG - Intergenic
1095323162 12:40854794-40854816 TCAGAAGAGCAGATGGCGGAAGG + Intronic
1095791883 12:46176409-46176431 ACTGAAGAGGCTGAGGTGGAAGG + Intergenic
1096000338 12:48124564-48124586 GCTCAGGATCAGAAGGTGGAAGG - Intronic
1096647325 12:53045971-53045993 ACCCTGGAGCAGAAGGTGGAGGG - Intergenic
1096694203 12:53338515-53338537 ACTGAAGGGGAAAAGGAGGAAGG + Intronic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1097024713 12:56046293-56046315 ACTGCAGAGCAGATGGTGAAGGG + Intergenic
1097313476 12:58147336-58147358 ACTGAAGAGCAGGGGTTGGGGGG + Intergenic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098355538 12:69609702-69609724 ACTGAAGAGCAAAAGGGGCTGGG - Exonic
1098509360 12:71293275-71293297 TCAGAAGAGGAGAAGGTGGGAGG + Intronic
1099037225 12:77603659-77603681 TTTGATGAGCAGAAGCTGGATGG + Intergenic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1099491056 12:83288548-83288570 GCTGAAGAGAAGAAAGAGGAGGG - Intergenic
1099652950 12:85451892-85451914 ACTGAAGAGGTGAAGGAGGTAGG - Intergenic
1099694628 12:86002120-86002142 ACTGAAGGGCTGAAGCAGGAAGG - Intronic
1101025141 12:100595937-100595959 AAAGAAGAGAAGAAGGAGGAGGG - Intronic
1101107689 12:101456178-101456200 ACTGAAGTGCAGTAGTGGGACGG + Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102372219 12:112391557-112391579 ACTGGAGATCAGAAGGATGAGGG - Intergenic
1102460891 12:113098927-113098949 ACTGAAGTCCAGAAGTTTGAGGG + Exonic
1102822966 12:115923847-115923869 ACAGAAGAGGAGAAGGAGAAGGG - Intergenic
1102904929 12:116667187-116667209 ACTGACAAGCTGAAGGTAGAAGG + Intergenic
1103613993 12:122140884-122140906 ACTGCAGACCCGAAGGTGGTTGG - Intronic
1103948686 12:124540573-124540595 AGTGAAGAGCTGGAGGGGGATGG + Intronic
1103948779 12:124540819-124540841 AGTGAAGAGCTGGAGGGGGATGG + Intronic
1103948882 12:124541124-124541146 AGTGAAGAGCTGGAGGGGGATGG + Intronic
1103948943 12:124541308-124541330 AGTGAAGAGCTGGAGGGGGATGG + Intronic
1105554156 13:21429871-21429893 ACTGAACAGCAGAATGGAGAGGG - Intronic
1106068482 13:26382087-26382109 AAGGAAGAGCAGAAGGAGTAAGG - Intronic
1106334052 13:28766429-28766451 ATTGTAGAGCAGCATGTGGATGG + Intergenic
1107368339 13:39711589-39711611 ACTGATGAGAAGGAGGAGGAAGG - Intronic
1107823125 13:44304205-44304227 GCTGCAGAGCAGAAGGTACACGG + Intergenic
1107823902 13:44310458-44310480 ACTGAAGATCAAAAGGGGGTTGG + Intergenic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1109019458 13:57068676-57068698 ACTGAAAAGAAGAAGGTGAATGG + Intergenic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109333848 13:60966966-60966988 ACTGAGGAGCATAAGGCAGAAGG - Intergenic
1109582172 13:64355111-64355133 GTTGAAGGGTAGAAGGTGGATGG + Intergenic
1109604087 13:64669136-64669158 ACTGTAGAGCAGATAGGGGATGG - Intergenic
1109714179 13:66199554-66199576 ACTTGAGAGTAGAAGGTGGGAGG + Intergenic
1109750189 13:66681788-66681810 AATAGAGAACAGAAGGTGGATGG - Intronic
1109942610 13:69390888-69390910 ATTGAAGATCTGAATGTGGAAGG - Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110656941 13:78011559-78011581 ACTCAAGAGCAGATGATGGGAGG + Intergenic
1110783738 13:79497990-79498012 ACTGAAGAGAAGTGGGTGGATGG + Intronic
1111450858 13:88413385-88413407 ACTGGAGGGCAGAGGGTGGGAGG + Intergenic
1113398694 13:109972286-109972308 ACCCAAGAGCAGGTGGTGGAAGG - Intergenic
1114401985 14:22418515-22418537 ATGGAAGAGCTGAGGGTGGAAGG - Intergenic
1114748428 14:25176098-25176120 ACTTCAGAGCAGAAGTTGAAGGG + Intergenic
1115035745 14:28854352-28854374 ACTCAGGAGCTGGAGGTGGAAGG + Intergenic
1115499155 14:34034123-34034145 GCTGATGAACAGAAGGTGCAAGG + Intronic
1115548226 14:34482038-34482060 ACTCAGGAGCCCAAGGTGGAAGG + Intergenic
1115731167 14:36271453-36271475 AATGAAGAGCAGCATGTGGCAGG - Intergenic
1116369523 14:44111312-44111334 CCTCAAGAGGATAAGGTGGAAGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1116999725 14:51360295-51360317 AATGAGGAGCAGAAGATAGAAGG - Intergenic
1117197249 14:53353029-53353051 ACTGAGGAGCATAAGGCAGAAGG - Intergenic
1117873395 14:60224061-60224083 ACTGACGAGAGGAGGGTGGAGGG + Intergenic
1118270453 14:64338378-64338400 ACTCCAGAGCAGAACGCGGAGGG + Intergenic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118747952 14:68787269-68787291 AATGAAGAGCACAGGCTGGACGG + Intergenic
1119200790 14:72751080-72751102 ACTGAGGAGGCCAAGGTGGAAGG + Intronic
1119707025 14:76789277-76789299 TCTGAAGAGCAGAAGGGGTTGGG + Exonic
1120408587 14:84121040-84121062 CCTGAAGCCCACAAGGTGGAGGG + Intergenic
1120713641 14:87817931-87817953 ACTCAAGAGGCTAAGGTGGAAGG + Intergenic
1120757662 14:88259003-88259025 ACTGGAGAGTAGAAAGTAGATGG - Intronic
1121156625 14:91691168-91691190 ACTGAAGAGAGTAAGGTGGTGGG - Intronic
1121412954 14:93760467-93760489 TCTGAAGAGCAGAATAGGGAGGG - Intronic
1122218797 14:100222231-100222253 AGTGATGAGCGGAAGCTGGAAGG + Intergenic
1122439571 14:101720828-101720850 ACTTGAGACCAGGAGGTGGAGGG + Intergenic
1123064786 14:105612155-105612177 ACAGCATAGCAGAAGGTGAAGGG - Intergenic
1123431008 15:20216330-20216352 ACTGAGGGGCAGAAGGCAGAAGG - Intergenic
1123811879 15:23935214-23935236 ACTCAATAGCAGAAGGTAAAGGG - Intergenic
1123847873 15:24322645-24322667 ACTGAAGAGGCTAAGGTGGGAGG - Intergenic
1124104566 15:26725348-26725370 TCTGAGGAGGGGAAGGTGGAGGG - Intronic
1124681566 15:31736056-31736078 ACTGGAGGGCAGAGGGTGGGAGG + Intronic
1125047719 15:35261722-35261744 ACTTGAGAGGCGAAGGTGGAAGG + Intronic
1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG + Intronic
1126283403 15:46983866-46983888 ACTTGAGGGCAGAGGGTGGAAGG - Intergenic
1126368615 15:47922208-47922230 ACTTAAGAGCAGAATGCAGATGG - Intergenic
1126927392 15:53605335-53605357 ACTGAAGAACAGAAGGTGGGAGG + Intronic
1127575123 15:60284470-60284492 TCTGAGGAGCATAAGGTAGAAGG + Intergenic
1129182356 15:73885285-73885307 ACTGAAGTGGAGAAGGGGGATGG + Intronic
1130885225 15:88087249-88087271 GCTAAAGAGTGGAAGGTGGAGGG + Intronic
1131028822 15:89168981-89169003 ACTCAAGAGGCTAAGGTGGAAGG + Intronic
1131872715 15:96778295-96778317 ATTGAACAGCAGAGGGTGGGGGG - Intergenic
1132143737 15:99414776-99414798 CCTGAAGCGCAGGAGGTGGTAGG + Intergenic
1132282714 15:100633962-100633984 GGTGAAGAGCAGAAGGTTGTGGG + Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1134235160 16:12459491-12459513 ACTGAAGAAGAGGAAGTGGATGG + Intronic
1134325580 16:13204607-13204629 CCTGAAGAGCAGAAGTTGCCTGG - Intronic
1135491908 16:22916619-22916641 ACTGAAGGTCCGAAGGTTGATGG + Intergenic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136671449 16:31862255-31862277 ACTGGAGAGTAGAAGATGGGGGG - Intergenic
1136853645 16:33634917-33634939 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1137738685 16:50743091-50743113 ATTGAGGAGAAGAAGGTGGCAGG - Intronic
1137952122 16:52793332-52793354 ACTGAAATGCAGCAGTTGGAAGG + Intergenic
1138931118 16:61657148-61657170 ACTGATGATCAGAAATTGGATGG - Intronic
1139111503 16:63897005-63897027 ACAGCAGAGGAGATGGTGGAGGG + Intergenic
1139270385 16:65676976-65676998 AGGGAAGAACAGAAGTTGGAAGG + Intergenic
1139515597 16:67450743-67450765 ACTGAAGAGAAGAATTCGGAAGG + Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140128056 16:72134209-72134231 ACTGAGGGGCAGAAGGCAGAAGG - Intronic
1140297327 16:73721599-73721621 GCTGAAGAGCAGATGGTGCATGG - Intergenic
1140364881 16:74373664-74373686 GGTGATGAGCAGGAGGTGGAGGG - Intergenic
1140453727 16:75092257-75092279 GCTGAAGAGGAGGAGGAGGAGGG + Intronic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140775249 16:78243509-78243531 ACTGGAGGGTAGAGGGTGGAAGG - Intronic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141596501 16:85100153-85100175 ACTGAAGAACAGATGGAGGGGGG + Exonic
1142137757 16:88459541-88459563 AATGAAGAGAAGGAGGAGGAAGG - Intronic
1142264856 16:89058938-89058960 ACTGATGGGCAGAAGGTCAAGGG - Intergenic
1203115236 16_KI270728v1_random:1483362-1483384 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1142779479 17:2169843-2169865 ACTGAAGAGTAGAAGGGGGAAGG + Intronic
1142804278 17:2363317-2363339 GCTGGAGAGCAGAGGGTGGCTGG + Intronic
1143114365 17:4573985-4574007 ACAGCAGAGCTGAAGTTGGAGGG - Intergenic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1144180423 17:12746382-12746404 GTAGAAGGGCAGAAGGTGGAAGG + Intronic
1144329793 17:14213167-14213189 GCCACAGAGCAGAAGGTGGATGG + Intergenic
1144363642 17:14520912-14520934 AATGGAGGGCAGAAGGTGGGAGG - Intergenic
1144393353 17:14817820-14817842 ACTTGAGAGTGGAAGGTGGAAGG - Intergenic
1144823275 17:18090306-18090328 ACTCAAGAGGTGGAGGTGGAAGG - Intronic
1145863609 17:28226840-28226862 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1147036783 17:37687492-37687514 AGCAAAGAGCAGCAGGTGGAGGG + Intronic
1147110343 17:38257063-38257085 GCTGAAGACGAGAAGGAGGAGGG + Intergenic
1147426138 17:40346746-40346768 AGTGAAGAGCAGACGGCGGTGGG + Intronic
1147927337 17:43953866-43953888 GCAGACGAGCAGGAGGTGGAAGG + Exonic
1147938674 17:44029487-44029509 ACTGAAGAGCAGATGGCAAATGG - Intergenic
1148419167 17:47531368-47531390 GCTGAAGACGAGAAGGAGGAGGG - Exonic
1148675343 17:49441657-49441679 AGGGAAGAGAGGAAGGTGGAGGG + Intronic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1149005523 17:51801301-51801323 ACTGACGACCACAAGTTGGATGG - Intronic
1149454500 17:56777003-56777025 ACAGAAGAGTGGATGGTGGAAGG - Intergenic
1149530315 17:57389882-57389904 ACAGAAGAGCAGAAGGAGCCTGG - Intronic
1149664504 17:58356413-58356435 GGGGAAGAGTAGAAGGTGGAAGG + Intronic
1150129314 17:62658475-62658497 ACTGAAGTCCAGAAAGGGGACGG - Intronic
1150414963 17:64979797-64979819 ACTGAAGGGCAGAATTGGGAGGG - Intergenic
1150804279 17:68306965-68306987 ACTGAGTAGCAGATGGTTGAGGG - Exonic
1150979236 17:70122998-70123020 ATTTAAGAGCAGAAGGAGGGAGG - Intronic
1151146493 17:72046456-72046478 GCTGAAGCACAGAAGGTGGCTGG + Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151579787 17:74971580-74971602 CCTGGAGAGCAGGAGGTGGGGGG + Intronic
1151616453 17:75215863-75215885 AGGAAAGAGCAGAAGATGGAAGG - Intronic
1151671977 17:75575871-75575893 AGTGGAGAGCGGAAGGTGGCTGG + Intergenic
1151821716 17:76500540-76500562 TCTGAGGAGCAGAAGGCGGTGGG - Intronic
1152095485 17:78269482-78269504 GCTGGAGAGGAGAGGGTGGACGG + Intergenic
1153468359 18:5415296-5415318 AATGATGAGCAGAGGGTGGTGGG + Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1154113021 18:11586491-11586513 ACTGAAGGGCATAAGGCAGAGGG - Intergenic
1155294356 18:24371674-24371696 AGTGAAGAGTAGAATGGGGAGGG - Intronic
1155546904 18:26924911-26924933 AATGAATAACTGAAGGTGGAAGG - Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1156110975 18:33726879-33726901 GCTAGAGAGCAGAAAGTGGAAGG - Intronic
1157216580 18:45788427-45788449 ACTGAAGAGGCTAAGGTGGGAGG + Intergenic
1157694169 18:49707795-49707817 ACTGCAGGGCAGAAGCTGGCTGG - Intergenic
1159150894 18:64522403-64522425 ACTGTATAACAGAAGGTGTATGG + Intergenic
1160822562 19:1065312-1065334 ACCGAAGAGCAGAAGGAGGCAGG + Exonic
1161320253 19:3637739-3637761 ACTGCCAAGCAGAAGGTGGGGGG + Intronic
1161393051 19:4031330-4031352 TCTGCAGAGCAGGACGTGGAGGG + Intronic
1162108873 19:8389499-8389521 AAAGAATAGCAGAAAGTGGACGG + Intronic
1162153788 19:8663409-8663431 ACTGAGGTGGGGAAGGTGGAGGG + Intergenic
1163705845 19:18812763-18812785 ACTGAAGAGGCTGAGGTGGAAGG + Intergenic
1164290447 19:23863876-23863898 ACTGGAGAGCAGATGGTGTGTGG - Intergenic
1164404544 19:27932349-27932371 GATGAAGAGAAGAAGGAGGAAGG - Intergenic
1164468037 19:28504947-28504969 CCTCTAGAGCAGAAGGTGGGAGG - Intergenic
1164539683 19:29113584-29113606 AGTGATGAGCAGCAGGTGGGTGG - Intergenic
1165370379 19:35401999-35402021 ACTGAAGAGGCTAAGGTGGGAGG - Intergenic
1166054714 19:40281381-40281403 ACTCAAGAGGATGAGGTGGAAGG + Intronic
1166443607 19:42838639-42838661 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166463300 19:43009301-43009323 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166480574 19:43169397-43169419 TCTGCAGTGCAGATGGTGGAGGG + Intronic
1167050575 19:47075448-47075470 ACTGAAGAGGAGGAGGAGGAGGG - Intronic
1167716282 19:51144552-51144574 ACTGAGGAGCGGGTGGTGGAGGG - Exonic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
925439494 2:3872145-3872167 GCTGCACAGCAGAAGGTGAACGG - Intergenic
926062784 2:9814488-9814510 ACTGGAGAGGAGAAGGGAGAAGG + Intergenic
926186153 2:10692445-10692467 ACTCAGGAGGATAAGGTGGAAGG - Intergenic
926714679 2:15914768-15914790 GCTGAAGTGCAGAAGGTTGGCGG - Intergenic
926979629 2:18554471-18554493 ACTGAAACGTAGAAGCTGGAGGG - Intergenic
927476344 2:23417101-23417123 AATGAAGAGAAGAAGGCTGATGG - Intronic
927577836 2:24215168-24215190 ACTGATGAGCAGAAGAAGAAAGG - Intronic
927774754 2:25893945-25893967 ACTGCAAAGCAGTAGGTGTAGGG + Intergenic
927882927 2:26701371-26701393 AGGGAAGTGGAGAAGGTGGATGG + Intronic
928503405 2:31922626-31922648 ACTGGAGGGTAGAAGGTGGGAGG - Intronic
929763611 2:44826205-44826227 TCTGGAGGGCAGAAGGTAGAAGG - Intergenic
930662495 2:54069034-54069056 ACTCAAGAGGATGAGGTGGAAGG - Intronic
931222771 2:60303155-60303177 ACCAAATAGCAGAATGTGGAGGG + Intergenic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931820617 2:65947852-65947874 ATTGGAGAGCAGAAGGTAAATGG - Intergenic
932148337 2:69344750-69344772 ACTGAAGAGCCTGAGGTGGGAGG - Intronic
933596693 2:84289921-84289943 GCTGCAGAACAGAAGGTGGGAGG + Intergenic
933737334 2:85505681-85505703 GCTGGAGAGCAGGAGGTGGAAGG - Intergenic
934027283 2:88011831-88011853 ACTGAGGAGGCTAAGGTGGAAGG - Intergenic
934109382 2:88727551-88727573 ACTGAAGGATAGAGGGTGGAGGG - Intronic
934114606 2:88775111-88775133 AATGAAGAACAAAATGTGGAAGG + Intergenic
934552074 2:95268750-95268772 ACTGAAGGGGAGAAGGTGTCAGG + Intergenic
934632027 2:95936745-95936767 AATGAAGAACAAAATGTGGAAGG - Intronic
934782791 2:96982953-96982975 GCTCAAGAGCTGAAGGTGGCAGG - Intronic
934801476 2:97166476-97166498 AATGAAGAACAAAATGTGGAAGG + Intronic
935142806 2:100368862-100368884 ACTGAAGGGGAGATGGGGGAAGG + Intergenic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936515779 2:113180563-113180585 GCTGCAGACCGGAAGGTGGATGG + Intronic
936868363 2:117103930-117103952 ATTGAAGATCAGACGGTGGTAGG + Intergenic
936952811 2:117995122-117995144 TCTGAAGAGCAGATGATGAATGG - Intronic
937365424 2:121257505-121257527 CCTGAAGAGCAGCAGGGGGCAGG + Intronic
937472191 2:122183658-122183680 CCTGAAGAGGAGAAGGTGAATGG + Intergenic
938995057 2:136669634-136669656 ACAGAAGAGCAGAAGCAGTATGG - Intergenic
939971343 2:148664637-148664659 CCTGAAGACCAGGAGGTGGAGGG - Intronic
940092728 2:149938944-149938966 GCTGCAGAGCAGAAGGAGGGAGG - Intergenic
940453903 2:153872568-153872590 AAAGCAGAGCAGAAGGTGGGCGG - Intronic
940500024 2:154482214-154482236 ACTGAAATGCAGAAGATGGCTGG + Intergenic
940868438 2:158839468-158839490 ACTGAGGGGCATAAGGTAGAGGG - Intronic
941753625 2:169161580-169161602 ACTCAAGAGGATGAGGTGGAAGG - Intronic
942757964 2:179364438-179364460 ACTGAAGAGACTAAGGTGGGAGG - Intergenic
943374156 2:187054687-187054709 ACTTAAGAGCAGTAGCTGGTGGG + Intergenic
944303453 2:198152138-198152160 CCAGAAGGGCAAAAGGTGGAAGG + Intronic
944539075 2:200739739-200739761 ACTGGTGAGGAGAAGGTGGCAGG + Intergenic
945139825 2:206673077-206673099 ACTGGAGGGCAGAGGGTGGGAGG - Intronic
945570125 2:211456882-211456904 GCCGCAGAGCAGAAGGTGAAGGG - Intronic
946002103 2:216491034-216491056 ACTGCAGAGCAGTAGGTGGAAGG - Intergenic
946130759 2:217604821-217604843 GATGAAGAGGAGAAGCTGGATGG - Intronic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947156887 2:227171729-227171751 ACTGAGGGGCAGAAGGCTGAAGG + Intronic
947358553 2:229322352-229322374 ACTGGAGGGTCGAAGGTGGAAGG + Intergenic
947637839 2:231689053-231689075 ACCGATGAGTAGCAGGTGGACGG - Intergenic
948510119 2:238458413-238458435 CCTGAAGTGCAGAAGCTGGTGGG + Intergenic
1168744448 20:226253-226275 ACTGGAGAGTGGAAGGTGGGAGG + Intergenic
1168874066 20:1158402-1158424 ACTGAAGTGCAGAAGTTTCATGG + Intronic
1168930009 20:1614064-1614086 ACTGAAGGCCAGAAGATAGAGGG + Intronic
1168957127 20:1841993-1842015 ACGGAAGGGCAGAAGCTGGGAGG - Intergenic
1169877073 20:10309713-10309735 ACAAAAGACCAGAAGGTGAAGGG + Intergenic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1171792100 20:29536675-29536697 ATTAAAGAGAAGAAGGTGAAAGG + Intergenic
1173193788 20:40896983-40897005 ACTGAGGCCCAGAAGATGGAAGG - Intergenic
1173298276 20:41778597-41778619 TGTGAAGAGCAGGAGTTGGATGG - Intergenic
1173763959 20:45589125-45589147 AGTGGAGAGGTGAAGGTGGAAGG - Intergenic
1173858332 20:46265823-46265845 GAAGAAGAGAAGAAGGTGGAAGG - Intronic
1174795297 20:53517271-53517293 ACTGGACAGCAGGAGGTGAATGG + Intergenic
1174928690 20:54789261-54789283 ATTGAAGATCAGATGGTTGAAGG + Intergenic
1175118555 20:56701337-56701359 AAAGAAGGGAAGAAGGTGGAGGG - Intergenic
1175192263 20:57219404-57219426 ACTGAGAAGCACAGGGTGGAGGG - Intronic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175631005 20:60536385-60536407 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1177180386 21:17738694-17738716 ATTGAAGAACAGAAGATGGAAGG + Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177391368 21:20477348-20477370 GCTGAAGAAGAAAAGGTGGAAGG + Intergenic
1177665228 21:24147950-24147972 ACTGAAGAGGATAAGGAGAAAGG - Intergenic
1180733437 22:17999209-17999231 ACAGAAGAGCAGAGGGTCAAAGG - Intronic
1180743680 22:18072158-18072180 ACTGAAGAGCACAAGGGAGGTGG + Intergenic
1180974716 22:19842024-19842046 CCTGATGAGCAGGAGGTGGGAGG - Intronic
1181425445 22:22834681-22834703 AATGAAGGGCAGGAGGTAGAAGG - Intronic
1181429689 22:22871552-22871574 AATGAAGGGCAGTAGGTAGAAGG - Intronic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181932384 22:26412704-26412726 ACTGAAAAGGAAAAGATGGAAGG + Intergenic
1182710739 22:32321613-32321635 ACTGAAGGGCGGAAGGTGGGAGG - Intergenic
1183100092 22:35578599-35578621 ACAGAAGACCAGGATGTGGATGG + Intergenic
1183268985 22:36849106-36849128 ACGGAAGGGCAGAAGGTGTAGGG - Intergenic
1183304187 22:37073333-37073355 ATTGGAGACCAGAAGATGGATGG + Intronic
1183357008 22:37364972-37364994 AATGAACAGCAGATGGTGGGAGG + Intergenic
1184266736 22:43351276-43351298 ACTGCAGGACAGAAGGAGGATGG - Intergenic
1184721187 22:46314478-46314500 TCTGAAGAGCAGAAAGGCGAAGG - Intronic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1184899267 22:47434182-47434204 AGTCAACAGCAGAAGCTGGAAGG + Intergenic
949361787 3:3240311-3240333 ACTGTTCAGAAGAAGGTGGAAGG + Intergenic
950904665 3:16527106-16527128 ATTGCAGAGAAGAAGGAGGAGGG + Intergenic
951305104 3:21050655-21050677 AAAGAAGAGTAGATGGTGGAGGG - Intergenic
952675819 3:36029201-36029223 ACTGAAGGGCATAAGGCAGAAGG + Intergenic
953508990 3:43516312-43516334 TCTGAAGAGCAGAAATTGGATGG + Intronic
954011793 3:47646679-47646701 AATGAAGTGCAGAAAATGGAGGG - Intronic
954207322 3:49069589-49069611 ACTGAAGAGGCTGAGGTGGAAGG - Intronic
954797377 3:53168433-53168455 GCTGGAGAGCGAAAGGTGGATGG + Intronic
955176053 3:56613886-56613908 ACTGAGGAGACCAAGGTGGAAGG - Intronic
956660807 3:71595362-71595384 GCAGAATAGCAGAAGGTAGAAGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
957499402 3:81034503-81034525 ACTGAATAGAAGACGGTTGAGGG + Intergenic
957550201 3:81694505-81694527 ACTGGAGAGTAGAAGGAGGCGGG - Intronic
957638651 3:82819723-82819745 AATGAAGAGCATCAGTTGGAAGG - Intergenic
958597486 3:96246269-96246291 ACTAAAGAACAGAAGGTGCTAGG - Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG + Exonic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961904175 3:130245382-130245404 ACTGAGAACCAGAAGGTGGTAGG + Intergenic
962020253 3:131492625-131492647 ACTGCACAGCAGGAGGTGAATGG - Intronic
962113526 3:132476040-132476062 ACTGGGGAGGCGAAGGTGGAAGG - Intronic
962600022 3:136984638-136984660 GCTGAAGAGCAGAGGAGGGAAGG + Intronic
962865573 3:139445725-139445747 AGTGCAGAGCAGAAAGGGGAAGG - Intergenic
963090413 3:141478375-141478397 ACTGTAGAGAAGAGCGTGGAGGG + Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963230743 3:142906654-142906676 ACTGAGGGGCATATGGTGGAAGG - Intergenic
963328151 3:143884713-143884735 ACTGAAGAGGGGACGGGGGAAGG + Intergenic
963405382 3:144856626-144856648 AGTAAAGAGGAGAAGGGGGAGGG - Intergenic
963509657 3:146231014-146231036 TCTGGAGGGCAGAAGGTGGGAGG - Intronic
963749288 3:149159151-149159173 ACTGCAGATGAGAAGATGGAAGG - Intronic
964648252 3:158981946-158981968 ATTGATGAGCTGATGGTGGATGG + Intronic
965069144 3:163895120-163895142 ATTAAATAGCAGAAGGGGGAAGG + Intergenic
965186342 3:165469342-165469364 ACAGAAGAATAGAAGGTGGATGG + Intergenic
965470614 3:169085734-169085756 TCTGCTGAGCAGAAGGTGCATGG + Intronic
965677183 3:171210176-171210198 ACGGAAGGACAGAAGGTAGAGGG + Intronic
966978151 3:185104804-185104826 ACTGCATACCAGAAGGTGGAGGG + Intronic
967104650 3:186245670-186245692 GGTGAAGAGGAGATGGTGGAAGG + Intronic
967690439 3:192467513-192467535 GCTGAAGAGGAAAACGTGGAAGG + Intronic
967768633 3:193310016-193310038 ACTTGAGAGCAGAGGGTGGGAGG - Intronic
967771667 3:193340595-193340617 AATGAAGAGAAGAAGAGGGAAGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
970332979 4:15003623-15003645 ACTGTTGAGCAGAGGGTGGTTGG - Exonic
971026658 4:22595322-22595344 AATGAACAACTGAAGGTGGAAGG - Intergenic
971032938 4:22660572-22660594 ACTGCACAGCAGAAGGTGAGTGG + Intergenic
971145896 4:23976127-23976149 AATGAAGGGCAGAATGTGCAAGG + Intergenic
971216795 4:24669708-24669730 GCAGAAGAGAAGAAGGAGGAAGG - Intergenic
971556302 4:28016396-28016418 AGTGAAAAGCAGCAGGTGAAAGG + Intergenic
972279511 4:37588548-37588570 GATGAGGAGAAGAAGGTGGAAGG - Intronic
972546950 4:40089057-40089079 ACTCAGGAGCCTAAGGTGGAAGG - Intronic
973191682 4:47392646-47392668 GCTGAAGATTAGAAGGTGGAAGG - Intronic
973312764 4:48727441-48727463 ACCCATGAGCAGAAGGTTGAGGG + Intronic
973978731 4:56288210-56288232 AAAGAAGAGCAGGAGGAGGAAGG - Intronic
975231809 4:71944403-71944425 ACTGAAGTACAGAAAGTGGTAGG + Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977718125 4:100207150-100207172 GCTGAAGTGCATAATGTGGATGG + Intergenic
977934115 4:102781061-102781083 ACTAAAGACTAGAAGTTGGAAGG - Intergenic
978153723 4:105466556-105466578 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
978290341 4:107130389-107130411 ACTGAAAGGCAGAAGGTAGCAGG + Intronic
979200620 4:117973717-117973739 GCTGAAGAGCAGAAGTTGTTTGG + Intergenic
980407548 4:132373227-132373249 ATGGTAGAGCAAAAGGTGGAAGG - Intergenic
981627157 4:146771406-146771428 ACTGGAGGGCAGAGGGTGGTAGG - Intronic
982107347 4:152022536-152022558 GATGAAGAGCAGTAGGCGGAGGG - Intergenic
982525182 4:156468503-156468525 ATTGAAGGGTAGAGGGTGGAAGG + Intergenic
983459883 4:168014843-168014865 ACGGAAGAGGAGAAGGTGATAGG - Intergenic
984053402 4:174895559-174895581 ATTGGAGGGTAGAAGGTGGAGGG + Intronic
984237733 4:177181124-177181146 AACCAAGAGCAGAATGTGGATGG + Intergenic
984715580 4:182921521-182921543 ACAGCAGAGCTGAAGGCGGAGGG + Intergenic
984781800 4:183533211-183533233 ACTGAAGGGCAGCAGGGAGAGGG + Intergenic
985444849 4:190016111-190016133 ACAGAAGAGCGCGAGGTGGAAGG - Intergenic
985445305 4:190018397-190018419 ACAGAAGAGCGAGAGGTGGAGGG - Intergenic
985693652 5:1327549-1327571 CCTGTAGAGCAGGAGCTGGATGG - Intronic
985842710 5:2320726-2320748 GCTCAAGAGCAGAAGCTGCAGGG - Intergenic
986135808 5:4976655-4976677 CCTGTAGAGCTGAAGGCGGAAGG - Intergenic
986245197 5:6000902-6000924 ACTGAACAGGAGAAGGGGAAGGG - Intergenic
986314747 5:6579136-6579158 CCTGAAGAGAAAAATGTGGATGG - Intergenic
986457404 5:7933119-7933141 ACAGAAGGGAAGAAGGGGGAGGG - Intergenic
987072954 5:14355021-14355043 ACTGAGGAGAGGAAGTTGGAAGG + Intronic
987853712 5:23390550-23390572 GCTGGAGTGCAGAAGGTGAAGGG - Intergenic
988078866 5:26389898-26389920 AGTGGAGAGGAGAAAGTGGAAGG + Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
988793642 5:34632346-34632368 ACTGAGGAACCCAAGGTGGATGG + Intergenic
989166394 5:38437161-38437183 ATTGCAGGGCAGAAGGTGCAAGG + Intronic
989578529 5:43010772-43010794 CCTGTGCAGCAGAAGGTGGATGG + Intergenic
989820822 5:45794249-45794271 ACTGAAGGGCATAAGGCAGAAGG + Intergenic
991048237 5:62245262-62245284 ACTGATGGGCAGAAGGCAGAAGG - Intergenic
991484845 5:67124189-67124211 ACCCAAGGGTAGAAGGTGGAGGG - Intronic
991563954 5:67985254-67985276 GATGAAGTGGAGAAGGTGGAAGG + Intergenic
991658419 5:68926453-68926475 ACTAAACTGCAGAAGCTGGAGGG - Intergenic
992458084 5:76934603-76934625 ATAAAAGGGCAGAAGGTGGAAGG + Intergenic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
993064037 5:83076835-83076857 AGTTAAGAGAAGAAGGTGGAAGG + Intronic
993139001 5:84006567-84006589 ACTTGAGAGCAGAGGTTGGAAGG + Intronic
993227419 5:85184696-85184718 TCTGAAGGGGAGAAAGTGGAAGG - Intergenic
993289919 5:86053874-86053896 ACTGGAGAACAATAGGTGGAAGG - Intergenic
993811261 5:92479499-92479521 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
994426711 5:99598828-99598850 ACTGAAGAGGCTAAGGTGGGAGG - Intergenic
994645699 5:102466174-102466196 ACTGGAGGGCAGAGGGTGGGGGG - Intronic
994863444 5:105230553-105230575 ACTGAAGAGGAGATGGTAAAAGG + Intergenic
995101523 5:108313078-108313100 ACCCAAGAGCAGAAGTTAGAAGG - Intronic
995191399 5:109322443-109322465 ACTGAGGGGCATAAGGTAGAAGG - Intergenic
995421894 5:111977137-111977159 AATGAAGAGCATATGGTGGGAGG + Intronic
995425333 5:112015055-112015077 TCTGGAGAGCAGAAGGAGGTTGG + Intergenic
995483251 5:112613977-112613999 AGTGAAAAGCAGAAGGGGAATGG + Intergenic
995532556 5:113106093-113106115 AGTGAACAGGGGAAGGTGGATGG - Intronic
995961136 5:117841221-117841243 ACTGAAGATCATAAGGTTGCAGG - Intergenic
995985239 5:118163272-118163294 TCTGGAGAGCAGAAGTTTGATGG + Intergenic
996037530 5:118774919-118774941 ACTGAAGCTCAGAAAGTGCAAGG - Intergenic
996572807 5:124950699-124950721 TCTGAAGTGCTGAAGGTTGAAGG - Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
996710886 5:126542554-126542576 ACTGGGGAGCATGAGGTGGAAGG + Exonic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
997709530 5:135992102-135992124 ACTGAAGAGCAGGAGGGCCAAGG - Intergenic
997854213 5:137358534-137358556 AAGGAAGAGGGGAAGGTGGAGGG + Intronic
998595667 5:143527324-143527346 ACTGGAGGGTAGAAGGTGGGAGG + Intergenic
998613377 5:143713309-143713331 GCAGATGACCAGAAGGTGGAGGG - Intergenic
998929319 5:147163144-147163166 AAGGAAGAGAAGAAGGGGGAAGG - Intergenic
999219132 5:149960609-149960631 ACAGAAGAGCACAAGCTGGAAGG - Intergenic
999284464 5:150386002-150386024 ACTGAGGATCAGAAAGTTGAGGG + Intronic
999438533 5:151582914-151582936 ACAGAAGAGCAGACGGGAGAGGG + Intergenic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999889373 5:155960145-155960167 AATGAAGAGGAGAAGGAAGATGG - Intronic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001536914 5:172504454-172504476 CCTGAAGCTCAGAAGCTGGATGG + Intergenic
1001827454 5:174756918-174756940 AATGAACAGAATAAGGTGGAAGG + Intergenic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1003830581 6:10005689-10005711 ACTGAAGACGAGCAGGAGGAAGG + Intronic
1004060947 6:12197591-12197613 ACCGTAGAGCAGAAGGGAGATGG + Intergenic
1004406216 6:15335975-15335997 ACTCAAGAGGCTAAGGTGGAAGG + Intronic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1005277642 6:24237208-24237230 AATTGAGAGCAGAGGGTGGAAGG + Intronic
1007110657 6:39311816-39311838 ACAGCAGTGCAGAAGGTGGGAGG + Intronic
1007122134 6:39391178-39391200 TCTGAAGACCAGAAGTAGGACGG + Intronic
1007238532 6:40408512-40408534 ACTCCAGAGCAGAAGTTGGCAGG + Intronic
1007398655 6:41591335-41591357 ACTGGGGCCCAGAAGGTGGAAGG - Intronic
1007905601 6:45457411-45457433 ACTGGAGAAGGGAAGGTGGAAGG + Intronic
1008016429 6:46525630-46525652 AAGGAAGAGAAGAAGGGGGAGGG + Intergenic
1008368272 6:50707133-50707155 AGTAAAGACCAGAAGATGGAGGG + Intergenic
1008420551 6:51294224-51294246 AGTGAAAATCAGCAGGTGGATGG - Intergenic
1008527217 6:52419331-52419353 ACTGAAGAGCTGCAGGTTGAAGG - Intergenic
1008666288 6:53720249-53720271 TCAGAAGTACAGAAGGTGGAAGG - Intergenic
1008928009 6:56907590-56907612 ACATAAGAGCAGAATGTTGAAGG - Intronic
1008939616 6:57032049-57032071 ACTGAAGGGCATAAAGTAGAAGG + Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009284431 6:61798014-61798036 ACTTGAGAGGAGAAGGTGGGAGG - Intronic
1009401552 6:63262302-63262324 ACTGAGGAGCATAAGGCAGAAGG + Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1010456198 6:76058602-76058624 AGTTAAGAGCAGAAGCTGTAAGG - Intronic
1011290461 6:85771779-85771801 ACTGAGGAGCATAAGGTGAAAGG + Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011983129 6:93410565-93410587 ACTGCAGTGCAGAAGGAGAATGG - Exonic
1012328217 6:97950599-97950621 ACTGAACAGGATAAGGTGGCTGG - Intergenic
1012898405 6:104978154-104978176 ACTGAAAAAAAGAAGGTGGGGGG - Intronic
1013970968 6:116017844-116017866 ACTGGAGAGAAAAAGGTGCAAGG - Intronic
1014045060 6:116876307-116876329 TCAAAAGAACAGAAGGTGGAAGG + Intergenic
1014527555 6:122519096-122519118 ACTGCACAGCAGGAGGTGAATGG + Intronic
1014893764 6:126874117-126874139 ACTGAGGAGTACAAGGTTGAGGG - Intergenic
1015409773 6:132880306-132880328 ACTGGAAAGCAAAAGTTGGAAGG - Intergenic
1015532129 6:134231078-134231100 ACTCAAGAGGTTAAGGTGGAAGG + Intronic
1015585405 6:134771058-134771080 ACTGAAAAGCAGGACGTGGCTGG - Intergenic
1016360301 6:143260354-143260376 ACTGAACTGAAGAAGTTGGATGG - Intronic
1016640150 6:146338870-146338892 AGAGAAGAGAAGAAGGAGGAAGG - Intronic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016790017 6:148058626-148058648 ACTGAATGGCAAAAGCTGGAAGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1018305944 6:162455285-162455307 ACTACAGAGGAGTAGGTGGATGG - Intronic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1018764510 6:166922833-166922855 ACAGAAGAGCAGATGGTGACAGG + Intronic
1019572965 7:1721871-1721893 ACTGAAGACCAGAGAGGGGAAGG - Intronic
1019817732 7:3213422-3213444 ACTGAGGGGCATAAGGTAGAAGG - Intergenic
1020358970 7:7306604-7306626 AATGAAGAGAAGAAGGTCCATGG + Intergenic
1021274573 7:18633714-18633736 AGTGAAGTGTAGAAGGTGGTAGG + Intronic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1021654453 7:22861601-22861623 TTTGAAGGGCAGAAGGTGCAGGG + Intergenic
1021930978 7:25581134-25581156 TGGGAAGAGCAGATGGTGGAGGG - Intergenic
1022082701 7:27038427-27038449 ACTGAAGAGGCTGAGGTGGAAGG + Intergenic
1022093343 7:27122652-27122674 AATAAACAGCAGAAGGTGAATGG + Intronic
1022993300 7:35729347-35729369 ACTGAAAAGCAGAAAGTGATGGG + Intergenic
1024135757 7:46406459-46406481 AGAGAAGGGCAGAGGGTGGATGG - Intergenic
1024469530 7:49752667-49752689 ACAGGAGAGAAGAAGGAGGATGG + Intergenic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1025763131 7:64413794-64413816 ACTGGAGAGTAGATGGTGGGTGG + Intergenic
1025909791 7:65819204-65819226 ACTGGAGAGGTGAAGGTGGGAGG - Intergenic
1026658413 7:72277395-72277417 ACTGAAGACCAGAAGATGTAAGG + Intronic
1027352924 7:77330028-77330050 ACTGAAAAGCAGAAAGTTTAAGG - Intronic
1027616557 7:80431302-80431324 ACTGAGGGGCATAAGGTAGAAGG - Intronic
1027978640 7:85188029-85188051 ATTTAAGAGCACAAGGTGTAGGG + Intergenic
1028307704 7:89286923-89286945 AAAGAAGTGGAGAAGGTGGAAGG - Intronic
1028581187 7:92411174-92411196 ACTGAGGAGCATAAGGCAGAAGG + Intergenic
1030451221 7:109714619-109714641 ACTGGAGATCAGAGGGTGGGAGG + Intergenic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1032139851 7:129318336-129318358 ACTCAAGAGCATGAGGCGGAAGG - Intronic
1033055539 7:138049895-138049917 ACTCAAGAGCCTGAGGTGGAAGG + Intronic
1033811143 7:145012772-145012794 ACTAGAGAGTAGAAGGTGGTTGG + Intergenic
1034875688 7:154722928-154722950 TCTGAAGAAAAGAAGATGGAAGG - Intronic
1035819786 8:2579028-2579050 ACTCATGAGCAGAAGCTGAATGG - Intergenic
1036655909 8:10677168-10677190 AATGAAGTGCAGGAGGAGGAGGG - Intronic
1036700656 8:11011734-11011756 AGTAAAGAGCTGAAGGAGGAAGG + Intronic
1037649886 8:20826645-20826667 AAGGAACAGCAGAAGATGGAAGG + Intergenic
1037824268 8:22151675-22151697 ACTGAAGACCAGAGGGAGAAGGG + Intronic
1038114596 8:24539192-24539214 ACTCAAGAGATGGAGGTGGAAGG + Intergenic
1040416001 8:47196685-47196707 GCTGGAGAGCAGTAGGGGGATGG - Intergenic
1041424585 8:57705967-57705989 ACGAAAGAGCCGAGGGTGGAGGG + Intergenic
1041470624 8:58204459-58204481 ACTTAAGGGCGGAGGGTGGATGG - Intergenic
1041681628 8:60598825-60598847 ACTTAAGGGCAAAAGGTCGAAGG + Intronic
1041807257 8:61865543-61865565 GCTGAAGACCAGAAGGGAGAAGG + Intergenic
1043457084 8:80423287-80423309 ATTTAAGGGGAGAAGGTGGAGGG - Intergenic
1043609625 8:82046001-82046023 ACTGAAGGGGAGATGGGGGAGGG - Intergenic
1044086540 8:87949333-87949355 ACTGAAGAGCAGATGGCTGTAGG - Intergenic
1044390255 8:91641594-91641616 AATGAAGAGCATAAGGAGGCAGG - Intergenic
1044422933 8:92019406-92019428 AAGGAAGAGCAGGAGGGGGAGGG + Intronic
1044973675 8:97643990-97644012 ACTGTAGACCAGAAGCTGGGAGG - Intergenic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046625464 8:116572311-116572333 GATGAAGAGAAGAAGGGGGAGGG - Intergenic
1047022844 8:120794808-120794830 ACTGAAGAACAGCTGATGGAAGG - Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047596191 8:126380043-126380065 CCTGGAGAACAGAAGTTGGATGG + Intergenic
1048732827 8:137462812-137462834 ACTGAGGATCGGATGGTGGAAGG - Intergenic
1049664945 8:143838848-143838870 AGGGCAGAGCACAAGGTGGAGGG + Intronic
1050122479 9:2321579-2321601 ACAGAAGATTAGAAGGTGGAAGG + Intergenic
1050162928 9:2736578-2736600 ACAGAAGAGCACACTGTGGATGG - Intronic
1050321297 9:4455258-4455280 ACTGAAGACCGTAAGATGGAAGG - Intergenic
1050361463 9:4835177-4835199 AGTGAAGAGCTGAAGGTGGCTGG + Intronic
1050930979 9:11326292-11326314 AATGAAGAGGTGAAAGTGGAAGG - Intergenic
1051033463 9:12713222-12713244 ACTGAAGGGTAGAAGGAGGCAGG + Intergenic
1052998324 9:34563703-34563725 ACAGGAGAGTAGAAGGTGGGAGG - Intronic
1053162140 9:35820494-35820516 CCTGAAGAGGAGAAGGAGGTTGG + Intronic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1054336537 9:63814170-63814192 ACAGTAGAGCACGAGGTGGAGGG - Intergenic
1056632202 9:88303173-88303195 AGTGCGGAGTAGAAGGTGGAAGG - Intergenic
1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG + Intergenic
1058647974 9:107148340-107148362 AAAAAAGAGCAGAAGCTGGAGGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059282721 9:113148762-113148784 ACTGCAGATCAGCACGTGGAGGG + Intergenic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1060287971 9:122271431-122271453 AATTAAGACCAGAAGGTGGTTGG + Intronic
1060397873 9:123328766-123328788 ATTGCAGAGAAGAAGCTGGAAGG - Intergenic
1060402219 9:123355712-123355734 ACTGGGGAGCAGCAGGTGGGGGG + Intergenic
1060556790 9:124512160-124512182 CCTGGAGAGCTGGAGGTGGAGGG + Intergenic
1062173776 9:135149508-135149530 ACTGCAGCCCAGCAGGTGGAGGG + Intergenic
1203443563 Un_GL000219v1:33763-33785 ACTGAAGACCAGAAGGCTGTGGG + Intergenic
1203514371 Un_KI270741v1:152672-152694 ACTGAAGACCAGAAGGCTGTGGG + Intergenic
1185886737 X:3789999-3790021 ACTGAAGGGCATAAGGCAGAAGG - Intergenic
1185969627 X:4648013-4648035 ACAGAGGAGCACAAGGTAGAAGG + Intergenic
1186204551 X:7187681-7187703 AATGAACAGCAGAAGCTGGTAGG + Intergenic
1186429533 X:9493068-9493090 ACTGATAAGAAGCAGGTGGAGGG - Intronic
1187492994 X:19770194-19770216 ACTTAAGGGTAGAGGGTGGAAGG - Intronic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188326240 X:28805245-28805267 AGTGAAGAGAGGGAGGTGGAAGG + Intronic
1188633141 X:32393326-32393348 ACTGAAGAGCATAAGGAGTTTGG + Intronic
1188666454 X:32827579-32827601 ACTCAAGAGTAAAAGGTGGGAGG - Intronic
1188726717 X:33593279-33593301 ACTGCAGAGTGGAGGGTGGAAGG + Intergenic
1189344781 X:40232697-40232719 ACTGGAGAGCAGAAAGTTGCAGG - Intergenic
1189728285 X:43990807-43990829 ATTGGAGTGCAGCAGGTGGAAGG - Intergenic
1190413053 X:50156120-50156142 GCAGATGAGCAGGAGGTGGAAGG - Intergenic
1190600134 X:52083374-52083396 ACTGGAGGGCAGAGGGTGGGAGG - Intergenic
1191920554 X:66252226-66252248 ACTGAAGAGGAGAAGGTTTGGGG + Intronic
1192279345 X:69667841-69667863 ACTCCATGGCAGAAGGTGGAAGG + Intronic
1192326014 X:70133174-70133196 GCTGAAGGGCACAGGGTGGAAGG + Intergenic
1192343271 X:70281300-70281322 CAACAAGAGCAGAAGGTGGAGGG - Intronic
1192564384 X:72151494-72151516 ACTGCACAGGAGCAGGTGGAGGG + Intergenic
1192729714 X:73790886-73790908 ATTGAAGAGCTGAGGGTGCAGGG - Intergenic
1194160134 X:90438884-90438906 ACTGAGGAGCCTAAGGTAGAAGG + Intergenic
1194548221 X:95264746-95264768 GCTGATGAGCAAAAGGTGTAAGG + Intergenic
1194786518 X:98091479-98091501 ACTTAAGAGTGGAAGGTGGGAGG - Intergenic
1194996456 X:100596223-100596245 ACTGAAGAGGATGAGGTGGGAGG + Intronic
1195783544 X:108490796-108490818 ACTTGAGAACAGAGGGTGGAAGG - Intronic
1195976479 X:110532880-110532902 GCTGAAGAGCAGAAGGCAGTGGG - Intergenic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1196201945 X:112896570-112896592 ACTGAAGAAGGGAGGGTGGAAGG - Intergenic
1196941967 X:120785883-120785905 ACTGAAGAACAGGAGCTGGAAGG - Intergenic
1197366345 X:125568205-125568227 TTTGAAGAGCAGGAGGTTGAGGG - Intergenic
1198932886 X:141879463-141879485 AGTGAGGAGGAAAAGGTGGAGGG + Intronic
1199012804 X:142777387-142777409 ATGGAAGAGCAGAAGGCTGAGGG + Intergenic
1199684489 X:150254379-150254401 GCTGAAGAGCAGGAGGAGGCTGG - Intergenic
1199687548 X:150277835-150277857 ACTGGAGAGCAGAAGGGCTATGG + Intergenic
1200121120 X:153791064-153791086 TCTGAAGAGCGGAAGGAGGCAGG - Intronic
1200506427 Y:4015836-4015858 ACTGAGGAGCCTAAGGTAGAAGG + Intergenic
1201065171 Y:10089824-10089846 ACAGAAGAGCGAGAGGTGGAGGG + Intergenic
1201735799 Y:17260211-17260233 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic