ID: 958781325

View in Genome Browser
Species Human (GRCh38)
Location 3:98546934-98546956
Sequence TGCCTTAAAAATAATGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 359}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958781318_958781325 20 Left 958781318 3:98546891-98546913 CCAAACTTTTTTTCCTATTTCCC 0: 1
1: 0
2: 2
3: 66
4: 635
Right 958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG 0: 1
1: 0
2: 3
3: 41
4: 359
958781317_958781325 29 Left 958781317 3:98546882-98546904 CCACTATTTCCAAACTTTTTTTC 0: 1
1: 0
2: 10
3: 87
4: 774
Right 958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG 0: 1
1: 0
2: 3
3: 41
4: 359
958781320_958781325 7 Left 958781320 3:98546904-98546926 CCTATTTCCCTGGAAAATTACAA 0: 1
1: 0
2: 1
3: 28
4: 364
Right 958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG 0: 1
1: 0
2: 3
3: 41
4: 359
958781323_958781325 -1 Left 958781323 3:98546912-98546934 CCTGGAAAATTACAATGAGGAAT 0: 1
1: 1
2: 5
3: 16
4: 275
Right 958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG 0: 1
1: 0
2: 3
3: 41
4: 359
958781322_958781325 0 Left 958781322 3:98546911-98546933 CCCTGGAAAATTACAATGAGGAA 0: 1
1: 0
2: 1
3: 21
4: 329
Right 958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG 0: 1
1: 0
2: 3
3: 41
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958781325 Original CRISPR TGCCTTAAAAATAATGAGCT GGG Intronic
900907058 1:5566807-5566829 TGCCATAAATAAAGTGAGCTTGG + Intergenic
901047804 1:6408767-6408789 TACATTAAAAAAAATTAGCTGGG - Intergenic
901193624 1:7427373-7427395 TGCCGTAGAAATACTGAGTTTGG - Intronic
901274465 1:7980386-7980408 TGCCTCAAAAACATTGAGGTTGG + Intronic
901359055 1:8680016-8680038 TGCCTTCAAAATAATCATCATGG + Intronic
902340639 1:15781351-15781373 TGTCTCAAAAAAAATTAGCTGGG + Intronic
903782903 1:25833592-25833614 TATTTTAAAAATAATTAGCTGGG + Intronic
904681305 1:32231240-32231262 TGCCTTAAAAAAAAAGTGGTGGG - Exonic
904929851 1:34078131-34078153 TGTCTAAAACTTAATGAGCTGGG - Intronic
905487510 1:38313764-38313786 TACATTAAAAAAAATTAGCTGGG + Intergenic
906083777 1:43112401-43112423 TGCCATTAAAAGAGTGAGCTAGG - Intergenic
906802074 1:48746693-48746715 TGACTTCAAAGTCATGAGCTGGG - Intronic
908185413 1:61648124-61648146 TGACTTCAAAATAATGTGGTAGG + Intergenic
908723015 1:67146595-67146617 TGCCTAAAAGATAATGGGCCAGG - Intronic
909185127 1:72477732-72477754 TGGCTTAAAAAAAATGACCATGG - Intergenic
911206239 1:95094028-95094050 TGCATAAAAAATAATGATATGGG + Intergenic
911962754 1:104327751-104327773 TGTCTTAAAAATAATGATCAAGG - Intergenic
912321884 1:108721138-108721160 TGCCTTACAGAGAATGAGTTAGG + Intronic
913200056 1:116488680-116488702 TGCCATAAAAATAAAAACCTTGG + Intergenic
914703499 1:150153487-150153509 TGCCTTAAAAAAAAAAATCTTGG - Intronic
914743492 1:150484326-150484348 TGACTCAAAAAAAATTAGCTGGG + Intergenic
915938884 1:160105913-160105935 TCCTTAAAAAATAATGAGATCGG - Intergenic
916147924 1:161758137-161758159 TACCTTTAAAAAACTGAGCTAGG - Intergenic
919920964 1:202166214-202166236 GGCCTCAAAGATAATGAACTTGG - Intergenic
920012807 1:202881792-202881814 TGCCTGAAGCATAATGAGCCGGG - Intronic
920205086 1:204285684-204285706 TGATTTAAAAATAATGAGCCTGG - Intronic
922939171 1:229446571-229446593 TACATTAAAAAAAATTAGCTGGG + Intronic
923388542 1:233490459-233490481 TGCAGTAATAATAATGAGCTGGG + Intergenic
924027975 1:239857234-239857256 TCCCTTATAAATATTGAGATCGG - Intronic
924856132 1:247876737-247876759 TTCCTTCAAATTAATGACCTTGG + Exonic
1063393926 10:5669061-5669083 TGCCTCCAAAATAAATAGCTTGG + Intergenic
1063694695 10:8322438-8322460 TAGAATAAAAATAATGAGCTTGG - Intergenic
1064270419 10:13860273-13860295 TGCCATAAAAATAATTAGGAAGG + Intronic
1064991637 10:21261792-21261814 TACCTTTAAAATAAAGAGATAGG + Intergenic
1065085159 10:22166557-22166579 TGCAGTAAACAGAATGAGCTTGG + Intergenic
1065719756 10:28615362-28615384 TCCCTTCAAAATAATGACCTTGG + Intronic
1065721240 10:28630312-28630334 TCTCTTAAAAATAAAGTGCTTGG + Intergenic
1065937689 10:30535331-30535353 TGCATTAAAAATAAGGAAATAGG - Intergenic
1068073663 10:52227164-52227186 AACCTTAAAAATAATGTGATGGG - Intronic
1068342603 10:55727190-55727212 TGGATTAAAAATTGTGAGCTAGG - Intergenic
1068499703 10:57828753-57828775 TTCATTAAAAATTCTGAGCTGGG - Intergenic
1068704517 10:60058999-60059021 TTCCTTTAAAATAATGAGGTGGG - Intronic
1071081598 10:81819191-81819213 TTACTAAAATATAATGAGCTGGG + Intergenic
1071592170 10:86884713-86884735 TGCATTAAAAATCATATGCTTGG - Intronic
1071595799 10:86923105-86923127 TTCCTTAAAAAAAATAAGCAAGG - Intronic
1071837637 10:89435264-89435286 TGCCTGAAAAATAATGAATATGG - Intronic
1073954011 10:108846639-108846661 TTCCTAATAAATAATGATCTTGG - Intergenic
1074293469 10:112159521-112159543 AGCCTTAAAAATCATCTGCTCGG - Intronic
1074501989 10:114034050-114034072 TGCCATAAAAACAAACAGCTGGG + Intergenic
1074644349 10:115429121-115429143 TGCCTTGAAAATGATTTGCTGGG + Intronic
1078737513 11:14034014-14034036 TCCTTTAAAAATATTAAGCTGGG + Intronic
1079983349 11:27175087-27175109 TGCCTTAAAAATAAACAAATAGG + Intergenic
1082043774 11:47708518-47708540 TCCTTTAAAAATTATCAGCTGGG + Intronic
1083612240 11:64009831-64009853 TGCCGTAAAAACAGTGGGCTCGG + Intronic
1084108018 11:66993304-66993326 TGCTAAAAAAATAATTAGCTGGG + Intergenic
1084629283 11:70335499-70335521 TGCTTTTAAAATAATGATCGAGG + Intronic
1084861532 11:72021762-72021784 TTTTTTAAAAAAAATGAGCTGGG - Intronic
1085452426 11:76642822-76642844 TCCCTTAAGAAGAATGACCTGGG + Intergenic
1085694264 11:78690459-78690481 TGCTTTAAAAATAATAAACATGG + Intronic
1086271644 11:85074406-85074428 TGCCTTATATATAATGAGCAGGG + Intronic
1086581945 11:88409418-88409440 TCCCTTAAAATTTAGGAGCTTGG - Intergenic
1086949207 11:92874439-92874461 TCCCTAGAAACTAATGAGCTTGG + Intronic
1088140162 11:106606385-106606407 TGCCTCAAAACTTATGATCTGGG + Intergenic
1089763094 11:120742930-120742952 AGCCATAAAAAGAATGAGATTGG + Intronic
1090909832 11:131109359-131109381 TGCCCTAAAAATACAGAGGTGGG + Intergenic
1091043243 11:132301857-132301879 TGCCATAAAAATATTAAGCAAGG + Intronic
1092626208 12:10332080-10332102 TGCCAAAAAAATAATAAGGTTGG + Intergenic
1092668831 12:10839246-10839268 TGCCTAGAGAATAATGAGGTGGG + Intronic
1093086905 12:14876183-14876205 TTCCTTTAAAGAAATGAGCTGGG - Intronic
1093254414 12:16849035-16849057 TCATTTAAAAATAATGAGCAAGG - Intergenic
1095662481 12:44753559-44753581 TGCCATATAAATAATGGCCTAGG + Intronic
1096646032 12:53036410-53036432 TGTCTTAAAAATAAAAAACTAGG - Intronic
1096713252 12:53473777-53473799 TGACTTAAAAAAAATGAGAAAGG - Intronic
1097625506 12:61995203-61995225 TGTCTGAAGAATAATGAGCTAGG - Intronic
1098256236 12:68618493-68618515 TACCTTGAAAATACTGATCTAGG - Intronic
1098895425 12:76054737-76054759 TGCATTAAAAGGCATGAGCTTGG - Intronic
1099066977 12:77993157-77993179 CGTCTTTAAAATAATGAGGTGGG + Intronic
1100825442 12:98470582-98470604 CCCCTAAAAAATAATAAGCTGGG + Intergenic
1101122079 12:101592770-101592792 GGGCTTAAAAAAAATGATCTTGG - Intronic
1103070087 12:117934170-117934192 TTACTCAAAGATAATGAGCTTGG - Intronic
1103432128 12:120897420-120897442 TGTTTTTAAAATAATGAGCAAGG + Intronic
1103835898 12:123820837-123820859 TGCCACCATAATAATGAGCTTGG + Intronic
1104674210 12:130701819-130701841 TGCCTTAAAACCAAGGAGCCGGG + Intronic
1105667111 13:22572421-22572443 ATCCTTAAAAATAATGAAATGGG + Intergenic
1105785982 13:23749801-23749823 TGCCTTAAAAATACTGTAATTGG + Intronic
1105862027 13:24424242-24424264 TGCATTTAAAAAAATGAGATAGG - Intronic
1106648195 13:31659830-31659852 TTCCATAAAAAAAATGACCTTGG + Intergenic
1107553413 13:41497312-41497334 TGCCTTCCAAAAAAGGAGCTGGG + Intergenic
1107729850 13:43337952-43337974 TGCCATACATATAATGAGCATGG - Intronic
1107781233 13:43904526-43904548 TGTCTTAGGAATACTGAGCTTGG - Intergenic
1108180727 13:47837371-47837393 TGGCTTAAAAATAAAGGGCCAGG - Intergenic
1108745666 13:53390955-53390977 TAACTTAAAAAAAATTAGCTGGG - Intergenic
1109383115 13:61591126-61591148 TCCTTATAAAATAATGAGCTTGG + Intergenic
1109643937 13:65227764-65227786 TGTTTTAGAAATAATGATCTTGG - Intergenic
1110811127 13:79811554-79811576 TACCCTGGAAATAATGAGCTTGG + Intergenic
1111173395 13:84560368-84560390 TACCTTAAAAAAAATAGGCTAGG + Intergenic
1113765591 13:112878972-112878994 TGCTTTAAAAATGACGACCTTGG + Intronic
1114335594 14:21686173-21686195 TGGCATTAAAATAATTAGCTTGG - Intergenic
1114462977 14:22900007-22900029 TGCCTTAATAATAAGGGGGTGGG - Intergenic
1114705043 14:24716162-24716184 TACCTTTAAAATGATGAGCCAGG + Intergenic
1115925644 14:38430484-38430506 TCCATTTAAAATAATGAGTTGGG - Intergenic
1117585156 14:57194043-57194065 TGCCTTAAAATGATTGAGATGGG - Intergenic
1117838002 14:59827669-59827691 TCCCTCACAAATAATTAGCTCGG + Intronic
1119122836 14:72095966-72095988 AACCTTAAAAATAATGAGGAGGG + Intronic
1119834430 14:77735444-77735466 TACTTTAAAAAAAATTAGCTGGG - Intronic
1120946904 14:90006538-90006560 TGTCTCAAAAAAAATTAGCTAGG - Intronic
1121399116 14:93656491-93656513 TCTCTTAAAAAAAATTAGCTGGG + Intronic
1121587905 14:95076342-95076364 TGCCTTAAAGACAATAAGATAGG - Intergenic
1121920544 14:97876806-97876828 TGCCTTGCCAATAATGAGCTGGG + Intergenic
1123962012 15:25413041-25413063 TGCCTTCCAAATTATGAGTTAGG + Intronic
1124356055 15:28995521-28995543 TGCCTTAAGAACAATGTGTTGGG - Intronic
1124946991 15:34278124-34278146 TCCTTTAAAAAGAATTAGCTCGG + Intronic
1125795072 15:42398015-42398037 TGTCTTAAAAAAAAAGTGCTGGG + Intronic
1126449508 15:48790543-48790565 TGACTATGAAATAATGAGCTTGG - Intronic
1127449969 15:59106593-59106615 TGCTTTAGACATAATGTGCTTGG - Intronic
1127929553 15:63583312-63583334 TCAATTAAAAAAAATGAGCTAGG + Intronic
1128033756 15:64504779-64504801 TGCCTTAAAAATAAGCAAATAGG - Intronic
1129414223 15:75366342-75366364 AACCATAAAAATAATGGGCTGGG - Intronic
1130515556 15:84623390-84623412 TTCTTTAAAAATAATGTTCTTGG - Exonic
1131084569 15:89565525-89565547 TTGCATAAAAATAATGAACTTGG - Intergenic
1131193495 15:90336116-90336138 GCCATTAAAAATAATGAGGTTGG - Intergenic
1133252721 16:4494575-4494597 TGCCTTTAAAAAAATAAGTTTGG + Intronic
1134157498 16:11855535-11855557 TGCCTTACAAGTAATGAGGGAGG - Intergenic
1136988028 16:35130003-35130025 TGCCCTAAGAACAAAGAGCTTGG + Intergenic
1137649422 16:50106971-50106993 TACCTTAAAATTCATGAGCAAGG - Intergenic
1137872178 16:51960959-51960981 TGCTTTAAAAATTAAGAGATAGG - Intergenic
1138382086 16:56609521-56609543 TGCCTTAAAAATAACGGACTGGG + Intergenic
1138468643 16:57213333-57213355 TGCTTTAAGAATAAGGAGCGAGG + Intronic
1138586628 16:57974619-57974641 TGTGTTAAAAATCATGAGTTAGG - Intergenic
1138928097 16:61616929-61616951 TGACTTAAAAATAGTGGGTTTGG - Intergenic
1139094322 16:63686089-63686111 TGTTTTAAAGATAATGGGCTGGG + Intergenic
1139229078 16:65265003-65265025 TGCCTCAAAAATTATAATCTTGG + Intergenic
1140313225 16:73868826-73868848 TGACATAAAAATATGGAGCTTGG - Intergenic
1141562958 16:84882127-84882149 TGATTTAAAAATAAAGAGCTGGG + Intronic
1144315500 17:14057085-14057107 TGCCTTAAAACTAAGGAAGTGGG - Intergenic
1144421406 17:15102410-15102432 TGCCTTGAAGATACTGAGCTGGG - Intergenic
1144449632 17:15365465-15365487 TGCTTTAAAAATCAGGACCTAGG - Intergenic
1144482817 17:15641516-15641538 TGTCTGAAAATTAAAGAGCTGGG + Intronic
1144915868 17:18723515-18723537 TGTCTGAAAATTAAAGAGCTGGG - Intronic
1146108104 17:30061735-30061757 TGTCTTAAAAATAATTAGCCAGG - Intronic
1147025452 17:37578809-37578831 TTTCTTAAGAATAAGGAGCTAGG - Intronic
1147700991 17:42394812-42394834 AGCCTTGAAAATATTGAGCTGGG - Intergenic
1148095110 17:45047283-45047305 TGCCTCGAAAAAAATAAGCTGGG - Intronic
1148263084 17:46201210-46201232 TGGGTTAAAAATAATGTTCTAGG - Intronic
1148703931 17:49611047-49611069 TGCCTTGAAAATGATGGCCTAGG + Intronic
1149866328 17:60153035-60153057 TGCTTTAAAAATAATAATGTTGG + Intronic
1150554870 17:66245391-66245413 AGCTTTTAAAATAATGAACTGGG - Intronic
1150558453 17:66274815-66274837 CACTTTAAAAATAATTAGCTGGG - Intergenic
1152284692 17:79405300-79405322 TGCATCAAAAATAATAAACTAGG - Intronic
1203166445 17_GL000205v2_random:101331-101353 AGCCTAAAAAATAATGAAATTGG + Intergenic
1152972486 18:176495-176517 AGGCTTAAAATTAATGAACTAGG - Intronic
1153575509 18:6516352-6516374 TACCTTAAAAAAAAATAGCTGGG + Intronic
1153602652 18:6796689-6796711 GGTCTTATAAATAATGAGATTGG + Intronic
1153808408 18:8730947-8730969 TTTCTTAAAAATAATTGGCTGGG + Intronic
1155281495 18:24245254-24245276 TGCCGAAAAAAAAATTAGCTAGG - Intronic
1155455770 18:26011170-26011192 TGCCTTGAAAATTAAGAGCAAGG - Intergenic
1157506736 18:48231704-48231726 TGCCTGCAATATAATGAGCAAGG - Intronic
1159137269 18:64351243-64351265 TGCCTTAAAAGGGATGAGGTGGG - Intergenic
1161716543 19:5879366-5879388 AGCCTTACAAAAAATGAGCTGGG + Intronic
1162424891 19:10588899-10588921 TGTCTCAAAAAAAATTAGCTGGG - Intergenic
1165459129 19:35934005-35934027 TGTCTTAAAAAAAAAGAGATGGG + Intergenic
1166896955 19:46029315-46029337 TTCCTTTAAAAAAATGGGCTGGG + Intergenic
925121752 2:1423675-1423697 TTCCTACAAAATAATAAGCTTGG - Intronic
925974884 2:9135281-9135303 AGCATTAAAAATAATTAGCATGG + Intergenic
926976135 2:18518868-18518890 GGCCTTAAGAAACATGAGCTTGG + Intergenic
927807884 2:26164199-26164221 TTGCTTAAAAATAATGGACTTGG + Intergenic
928418614 2:31119854-31119876 GTCATTAAAAATAATGAGCTAGG + Intronic
929155435 2:38784633-38784655 TGCCATCAGACTAATGAGCTGGG + Exonic
929917696 2:46150015-46150037 TCTCTTAAAAAAAATTAGCTGGG - Intronic
930361920 2:50391424-50391446 TGCTTTAAAAATAATCTTCTTGG + Intronic
930392358 2:50778268-50778290 TGCCTTAAAAACACTGAGTTGGG - Intronic
930710734 2:54548962-54548984 TTCCTTAAAGATACTGGGCTGGG + Intronic
931646139 2:64423841-64423863 TGCCTTTAAAATGGAGAGCTTGG - Intergenic
931801532 2:65762980-65763002 AATCTTAAAAATCATGAGCTGGG + Intergenic
933037849 2:77423271-77423293 TGCCCTAAAATAAATGAGCTTGG - Intronic
933382619 2:81568901-81568923 AACCATAAAAATAATTAGCTGGG + Intergenic
933443489 2:82346219-82346241 TGCCTTAAGTGTAGTGAGCTAGG - Intergenic
933695028 2:85211378-85211400 TGGTTTAAAAAGAAAGAGCTGGG + Intronic
934163703 2:89275390-89275412 TGCCCTATAAATAAGGAGCCTGG + Intergenic
934203569 2:89907134-89907156 TGCCCTATAAATAAGGAGCCTGG - Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
935321333 2:101892209-101892231 TGCATTAAGAACAATGAGGTAGG - Intronic
936528378 2:113257819-113257841 TGCATTTAAAATACTCAGCTTGG - Intronic
937756656 2:125547339-125547361 TTCTTTAAAAATATTGAGCCTGG - Intergenic
938365936 2:130734396-130734418 AGGCTCAAAATTAATGAGCTAGG + Intergenic
938682902 2:133710495-133710517 TGACATAAAAATAATGAATTTGG - Intergenic
938915043 2:135929729-135929751 TGTATTGAAAGTAATGAGCTAGG + Intronic
939324216 2:140667047-140667069 TGTGTTTAAAATAAGGAGCTAGG + Intronic
940013304 2:149077632-149077654 TTCTTTAAAATTAGTGAGCTGGG + Intronic
940816834 2:158306220-158306242 TGCATTAAAAATAGTGATTTTGG + Intronic
940843355 2:158610908-158610930 AGTGTTAAAAAGAATGAGCTTGG - Intronic
942077535 2:172370293-172370315 TGCAATAAAATTAATGACCTGGG + Intergenic
942136096 2:172926869-172926891 TGCCTAAAAAATGAGGACCTCGG - Intronic
942464680 2:176195276-176195298 TCCCTTAAGAATAATGTTCTTGG - Intergenic
942964329 2:181872799-181872821 AACCTTAAAAACAATGAACTTGG - Intergenic
943054237 2:182956043-182956065 TGTCTCAAGAATAATGAACTGGG - Intronic
943215301 2:185026046-185026068 TGCCCTAAAAAAATTGAGATGGG - Intergenic
943379370 2:187124333-187124355 TGCATTAATAATAAAGAGATAGG - Intergenic
944235770 2:197440173-197440195 TCCTTTAAAAATAATTTGCTGGG - Intergenic
944946432 2:204692055-204692077 TGGCTTAAGAATAAAGAGCCTGG - Intronic
945048568 2:205802446-205802468 GGCATTAAAAATAGTCAGCTGGG - Intergenic
945398477 2:209350844-209350866 TACCTAAAAAATAAAGAGTTAGG + Intergenic
945692660 2:213058872-213058894 GGCCTGAAAGATAGTGAGCTTGG - Intronic
947237476 2:227957725-227957747 TGCATTAAAAAAAATCACCTTGG + Intergenic
947577047 2:231283891-231283913 TCTCTTAAAAAAAATTAGCTAGG - Intronic
948533050 2:238625494-238625516 TGCATTAAAAATCATGTTCTAGG - Intergenic
1168731730 20:88694-88716 TCGATTAAAAATAATGAACTAGG - Intronic
1169107180 20:3006344-3006366 TGTCTAAAAAATAATCAGCCAGG - Intronic
1169452786 20:5726455-5726477 TTCCTTTAAAAAAATCAGCTGGG - Intergenic
1169634650 20:7675796-7675818 TTTGTTAAAAATAATGAGATGGG + Intergenic
1170327093 20:15168684-15168706 AGCCATAAAAAGAATGAGCCAGG + Intronic
1170540088 20:17379004-17379026 AGCCTTACAAATAATTAACTTGG + Intronic
1170617184 20:17963303-17963325 AGCCTTAAAAAAAATCACCTAGG + Intronic
1171015484 20:21537412-21537434 TGCTCAAAAAATAATGAGATGGG - Intergenic
1172309478 20:33906585-33906607 TGTTTTAAAAAAAATTAGCTGGG + Intergenic
1172350805 20:34239033-34239055 TCCCTTAGAAATAATTAGCCAGG - Intronic
1175602341 20:60285141-60285163 TCCCTTCAAATTAATGAGCCTGG + Intergenic
1176405310 21:6357765-6357787 AGCCTAAAAAATAATGAAATTGG - Intergenic
1176431847 21:6631338-6631360 AGCCTAAAAAATAATGAAATTGG + Intergenic
1177679898 21:24353538-24353560 TGCCTTAAAAATACTGTCCAAGG - Intergenic
1178459153 21:32785811-32785833 TGTCTTAAAAAGCATGAGTTTGG + Intergenic
1179042260 21:37814596-37814618 AGCCATAAAAAGAATGAGATCGG + Intronic
1181035322 22:20167172-20167194 TGTATGAAAAATAATTAGCTGGG + Intergenic
1181091699 22:20477443-20477465 TCTCTTAAAAAAAATTAGCTGGG + Intronic
1182666657 22:31965068-31965090 TGCATTAAAAAAAATCAGCCAGG - Intergenic
1183753562 22:39737548-39737570 TGGCTTAACAATAATATGCTTGG + Intergenic
949186306 3:1196046-1196068 TGCATTAACAATAATGAGATGGG - Intronic
950961517 3:17113108-17113130 TGCCTTCAATATAAAGAGCATGG + Intergenic
951322102 3:21257503-21257525 TCCTATTAAAATAATGAGCTTGG - Intergenic
951624188 3:24642186-24642208 TGCTTTAAAAATAATAACTTTGG - Intergenic
952264465 3:31772027-31772049 TGACTTAAAAAAAATCTGCTAGG - Intronic
952587963 3:34915922-34915944 TGCCTGGAAAATAAAGATCTTGG + Intergenic
952745577 3:36774096-36774118 TGCCTTAAATTTTATGAGCCAGG - Intergenic
953234359 3:41093319-41093341 TGCTTCAGAAATCATGAGCTTGG - Intergenic
953891093 3:46752087-46752109 TCTCTTAAAAAAAATTAGCTGGG - Intronic
953918079 3:46933324-46933346 TGCCTTAAAAACAAGGAGGCCGG + Intronic
956014654 3:64868949-64868971 TGCATTAGAAATTCTGAGCTAGG + Intergenic
956226609 3:66966694-66966716 TACCATAAAATGAATGAGCTTGG + Intergenic
956630639 3:71313357-71313379 TGCTTTTTAAATAATTAGCTTGG - Intronic
957257468 3:77856641-77856663 CGCTTTAAAAATAAAAAGCTGGG + Intergenic
957708143 3:83816713-83816735 TGCCTGAGAAAAAATGAGCAGGG - Intergenic
958263695 3:91412456-91412478 TCACTGAAAATTAATGAGCTTGG - Intergenic
958781325 3:98546934-98546956 TGCCTTAAAAATAATGAGCTGGG + Intronic
959114070 3:102155494-102155516 AGCTTTAAAAAGAATGAGATTGG + Intronic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
960706177 3:120483311-120483333 TGCTTTAAATATAATGATATAGG - Intergenic
960993599 3:123327047-123327069 TGCTTTAAAAATTAAGAGCATGG + Intronic
962225745 3:133606029-133606051 TGCCAAAAAAAAAATTAGCTGGG + Intronic
963114071 3:141710878-141710900 TGCCTGAAAAATAACCAGTTTGG - Intergenic
963229659 3:142896279-142896301 TTCTTTAAATATGATGAGCTGGG - Intergenic
963702790 3:148646667-148646689 TTCCTTAAAAATAAAAAGCTAGG - Intergenic
963720544 3:148857376-148857398 TGCCTTAAAAATAATGTACAGGG + Intronic
965299900 3:166996319-166996341 TGCCTTAAAAATAATCTCCTTGG - Intergenic
966447591 3:180020688-180020710 TGCCTTAAAAAAAATCAGACAGG + Intronic
967240435 3:187433618-187433640 AGCCTTTCAAATAATGAGCATGG - Intergenic
967432974 3:189409537-189409559 AGCCTTAAAAATAATTACGTAGG - Intergenic
967520336 3:190424011-190424033 TGCCTTAAATATAATATTCTGGG + Intergenic
970821956 4:20227458-20227480 TGCCTTTAAAATATTCAGCTTGG - Intergenic
972131325 4:35837808-35837830 CACCTTAAAAATAATGATCATGG + Intergenic
972260082 4:37398860-37398882 TGGCTAAGAAATAAGGAGCTAGG + Intronic
972517474 4:39821698-39821720 TGTCTCAAAAATAATAGGCTGGG - Intergenic
973701171 4:53538773-53538795 TGGCTTGAAAATAATGAGACTGG - Intronic
973988176 4:56376182-56376204 AACATTAAAAATAATTAGCTGGG - Intronic
974064120 4:57061833-57061855 TTTTTTAAAAATAATGAGATAGG + Intronic
974083983 4:57239959-57239981 TGCCATAAAAACAATGAGCATGG - Intergenic
976257420 4:83113033-83113055 TGACTTAGATAGAATGAGCTAGG + Intronic
976277366 4:83291010-83291032 TTCCTTAAAATAAATCAGCTGGG + Intergenic
979584194 4:122395384-122395406 TTCATTAAAAATAATGAGGCCGG + Intronic
980630194 4:135421365-135421387 TGCATTAAAAGTATTGAGTTAGG - Intergenic
981946621 4:150352480-150352502 TGCCTTAAAAATACTTAGCTAGG + Intronic
982721444 4:158864192-158864214 TGCCTTTACAAAAATTAGCTGGG - Intronic
984925301 4:184801219-184801241 TGCCTTAAAAATCAGTAGCTGGG + Intronic
985276404 4:188242035-188242057 GGGCTTAAAAATAATGACATGGG + Intergenic
987638194 5:20574636-20574658 TGGACTAGAAATAATGAGCTGGG - Intronic
988085080 5:26464714-26464736 TTCCTTAAAAATAATGAGTTTGG + Intergenic
988144169 5:27282447-27282469 TGCCTTAAAAGTACTCAGTTTGG - Intergenic
988374323 5:30414470-30414492 AGCCTTGATAATATTGAGCTAGG - Intergenic
989353225 5:40512069-40512091 TGGATTAAAAATAATATGCTAGG + Intergenic
989613605 5:43318010-43318032 TTCCTTAAAAATTATATGCTTGG - Intergenic
989722235 5:44542915-44542937 TGCCTAGAAAATAATGGGGTTGG + Intergenic
990001901 5:50903342-50903364 TGCTTTAGAAATGATGAGATAGG - Intergenic
990153095 5:52842844-52842866 TACATTAAAAAAAATTAGCTGGG - Intronic
990427784 5:55705594-55705616 TGCCTTAAAAAGGAGGAGTTAGG + Intronic
990666528 5:58078860-58078882 TGCCTAAAACATAATGGTCTTGG + Intergenic
992298338 5:75350415-75350437 AATCTTAAAAATAATGAGATTGG - Intronic
992900703 5:81292238-81292260 TGACTTATATATAATGAGCTGGG + Intergenic
992996394 5:82338378-82338400 TGTCTTTAAGATAATGAGCCAGG + Intronic
993147153 5:84109963-84109985 TGCTGAAAAAATAATGAGCTTGG + Intronic
994335344 5:98558528-98558550 GGTCTTAGAAAGAATGAGCTGGG - Intergenic
994903894 5:105811213-105811235 TCCCTAAAATATAATGAGATGGG - Intergenic
995774945 5:115715013-115715035 TGCTTTAAAAATTATGATGTAGG + Intergenic
996259156 5:121444897-121444919 TGCTTTACAAATAATCAGCTTGG + Intergenic
996417090 5:123222343-123222365 TACATGAAAAATAAAGAGCTGGG - Intergenic
997907062 5:137828460-137828482 CACCTTGAAAAGAATGAGCTTGG - Intergenic
1000460060 5:161504603-161504625 AGCCTTAACATTAATGATCTAGG + Intronic
1000595096 5:163206654-163206676 TGTCTCAAAAACAAGGAGCTGGG - Intergenic
1001751637 5:174135905-174135927 GCCCTTAAAAACAAGGAGCTGGG + Intronic
1001790256 5:174450188-174450210 TGACTTCATAAGAATGAGCTTGG - Intergenic
1003417488 6:5925091-5925113 TGTGATAAAAAGAATGAGCTTGG - Intergenic
1005019368 6:21402848-21402870 TGCCTTAAATTTAAACAGCTGGG + Intergenic
1006284767 6:33084483-33084505 TGCCTAAGAAATAATAATCTGGG + Intronic
1008794940 6:55291704-55291726 TGTCTGAGAAATAAAGAGCTAGG - Intergenic
1009180254 6:60508763-60508785 TCACTGAAAATTAATGAGCTTGG + Intergenic
1012262279 6:97101106-97101128 TGATTCAAGAATAATGAGCTTGG - Intronic
1012769789 6:103417781-103417803 TTCATCAAAAATAAAGAGCTAGG + Intergenic
1012799742 6:103809913-103809935 TGCCTTAAAATAAATGTGGTAGG - Intergenic
1013052015 6:106545680-106545702 TGCCTCAAAAAAAAAGAGTTAGG - Intronic
1013732951 6:113190526-113190548 TGCATTAAAAATAATTTGCAGGG + Intergenic
1015576971 6:134681926-134681948 TGTCTCAAAAATAATAATCTGGG + Intergenic
1015774469 6:136799790-136799812 TGGCTTAAAAATAATATGGTAGG + Intergenic
1016060330 6:139623184-139623206 AGCATTAAAAATATTGGGCTAGG - Intergenic
1016769784 6:147836125-147836147 TGCCTTGAAAATACTGGGGTTGG - Intergenic
1017326237 6:153144140-153144162 TCCCTAAAAAAAAATTAGCTTGG + Intergenic
1020743405 7:12050864-12050886 GGCCTAAAATATAAAGAGCTAGG - Intergenic
1021045115 7:15913085-15913107 TGTCTCTAAAATAATGAGCAAGG - Intergenic
1021437970 7:20643016-20643038 TGCATTGAATATAATGATCTAGG - Intronic
1022231151 7:28413578-28413600 TACATTAAAAATAGTGGGCTTGG - Intronic
1022568687 7:31429701-31429723 TGTTTAAAGAATAATGAGCTTGG - Intergenic
1024521836 7:50311960-50311982 TACCAAAAAAATAATGACCTGGG + Intronic
1025153327 7:56578376-56578398 TTCCTTAAAAGTACTGACCTAGG - Intergenic
1026271192 7:68838426-68838448 TTCTTAAAAAATAGTGAGCTGGG - Intergenic
1026287742 7:68978180-68978202 TGCTTAAAAAAAAAGGAGCTAGG - Intergenic
1026351490 7:69519237-69519259 TCTCTTAAAAAAAATCAGCTGGG - Intergenic
1028289939 7:89052755-89052777 TGCCTGAAAAAGAATGAATTGGG - Intronic
1029212498 7:98920303-98920325 TGCACTAAAAAAAATTAGCTGGG + Intronic
1030249444 7:107426338-107426360 TGCCTTAGTAATTATGAACTTGG - Intronic
1031302790 7:120084398-120084420 TGCCCTGAAAATAATAAGCCTGG - Intergenic
1031824053 7:126541022-126541044 TGCCTTAAACAAAATGGGCATGG - Intronic
1031927649 7:127653048-127653070 TCCCTTAAAGATAAGGAGATAGG + Intronic
1031979180 7:128113332-128113354 TGCCTCCAAAAAAATGAGTTGGG + Intergenic
1032520710 7:132542026-132542048 TGCTTTAAAAAAAATGAAATAGG + Intronic
1034152456 7:148927699-148927721 AGCCCTAAAAATAATTAGGTAGG - Intergenic
1035356265 7:158277682-158277704 TGTCTCCAAAACAATGAGCTGGG + Intronic
1035591756 8:821484-821506 TGCCATGGAAAAAATGAGCTGGG + Intergenic
1036702553 8:11022746-11022768 AGCTTTAAAAATAAAAAGCTTGG - Intronic
1037058843 8:14481332-14481354 TGACTTATAAGTAATGAGATGGG + Intronic
1037136503 8:15468937-15468959 TGACTTAAAAATAATGAGGGAGG + Intronic
1037310861 8:17554755-17554777 TGCATTAAAAATACAAAGCTAGG + Intronic
1037343496 8:17872596-17872618 TGCATTAAAAATAAACAGCTGGG - Intronic
1037616651 8:20525328-20525350 TCCCTAAAAAAAAATTAGCTGGG - Intergenic
1037650962 8:20838205-20838227 GGACATAAAAATTATGAGCTAGG + Intergenic
1038848828 8:31254772-31254794 TGCCTTCAGACTAAAGAGCTTGG - Intergenic
1040926237 8:52686789-52686811 TGCCTTTAAAATAATGATTCTGG - Intronic
1041261303 8:56022630-56022652 TGTCTTAAAAATAAATAGCTGGG - Intergenic
1044005829 8:86935976-86935998 TCTCTTAAAAAAAATTAGCTGGG + Intronic
1044258010 8:90088611-90088633 AGCCTTAAAAAAAATGAGGTGGG - Intronic
1045230520 8:100302030-100302052 TGGCTGAAAATTAATGAGCAAGG + Intronic
1045441808 8:102221216-102221238 TTCTTTAAAAATTATTAGCTTGG - Intronic
1045464229 8:102454421-102454443 AACCTTAAAAATAATTAGCTGGG + Intergenic
1045660406 8:104431500-104431522 TGCCTTAGAAATAGTGAAATAGG - Intronic
1045851204 8:106700254-106700276 TATTTTAAAAATAATGAGATGGG + Intronic
1046082994 8:109395135-109395157 TGATTTAAAAATAATGAATTTGG - Intronic
1046455168 8:114449820-114449842 TGCCTTAAAAATAATGGTCTTGG + Intergenic
1046823176 8:118657849-118657871 TACTTTTAATATAATGAGCTTGG + Intergenic
1047960165 8:130005692-130005714 TGCCTTAAAAATTAAAAGCTGGG + Intronic
1048548117 8:135405539-135405561 TGCCTTAAAAAGAAAGGGCAAGG - Intergenic
1049512047 8:143032932-143032954 TGCTTTAAAAATAATGGTATAGG + Intergenic
1050063627 9:1736104-1736126 TGCTTTAAAATTAAGCAGCTAGG + Intergenic
1050176131 9:2871260-2871282 TGTCTTTAAAATAATGGGCCAGG - Intergenic
1051553275 9:18354665-18354687 TGACTTAAAAATAAATATCTGGG + Intergenic
1052447359 9:28580352-28580374 TGCCTTAAAACCACTGTGCTGGG - Intronic
1052934773 9:34083891-34083913 TGCCTTAAAAATCCTGACTTCGG + Intergenic
1053094871 9:35317359-35317381 AGCATTAAAAAAAATCAGCTGGG - Intronic
1054836429 9:69679288-69679310 TGACTCAAAAATAAGGAGCCTGG + Intergenic
1055098946 9:72443170-72443192 TGCCTCAAAAAAAAAGAGCTAGG - Intergenic
1055278229 9:74643596-74643618 TGCCATAAAAATATTGAAGTAGG + Intronic
1055336992 9:75242552-75242574 TGCCTTAGAACAAATGAGTTGGG + Intergenic
1055767962 9:79685358-79685380 AGCATTTAAAATAAAGAGCTTGG + Intronic
1056031012 9:82553237-82553259 TTCATTAAAAATAATCATCTGGG - Intergenic
1056667811 9:88595634-88595656 TGACACAAGAATAATGAGCTGGG + Intergenic
1057021547 9:91701725-91701747 AGCCATAAAAATAAGGAACTAGG - Intronic
1057103678 9:92389902-92389924 TGCATTAAATAAAGTGAGCTTGG + Exonic
1058312944 9:103528899-103528921 TCTCTTAAAAAAAATGAGGTTGG + Intergenic
1058406904 9:104687008-104687030 TGTCTCAAAAATAATAAGTTAGG + Intergenic
1058440472 9:105001981-105002003 GCCATTAAAAATAATGAGGTAGG + Intergenic
1059916596 9:119110088-119110110 TGCCTTAAAAAGCAATAGCTTGG - Intergenic
1060325343 9:122609194-122609216 TGTCTTAAAAATAATGATGTAGG + Intergenic
1060329617 9:122655142-122655164 TGCTTTGAAAATAATGTGCCTGG - Intergenic
1060369856 9:123058259-123058281 TGCATTAAAAATACTAAGGTAGG + Intronic
1061398635 9:130356611-130356633 TGCCTGAAAGATAAGGAGCTAGG - Intronic
1061837570 9:133339667-133339689 TGCCCTCAAAATAAAAAGCTTGG + Exonic
1061995917 9:134185703-134185725 AACATTAAAAAAAATGAGCTGGG + Intergenic
1203439692 Un_GL000195v1:177370-177392 AGCCTAAAAAATAATGAAATTGG - Intergenic
1186303586 X:8228386-8228408 TACCTGAAAAATGATGAGTTTGG - Intergenic
1186788346 X:12973903-12973925 TGCCATAAAAATGATTAGCAAGG + Intergenic
1189189878 X:39090971-39090993 TTCTTTAAAAATGTTGAGCTGGG - Intergenic
1191229296 X:58081438-58081460 TGCCTTAGAAATCCTGAGGTTGG - Intergenic
1191839522 X:65501769-65501791 TGCCTGAAAAATAATGCCTTGGG - Exonic
1193057599 X:77170242-77170264 TGCCATAACAAAAATGAACTTGG + Intergenic
1194398049 X:93411103-93411125 TGCCTTAAACACAATGAGAATGG + Intergenic
1196604363 X:117639611-117639633 AACCTTAAAAATAATGACGTTGG + Intergenic
1197144721 X:123158766-123158788 CGTCTCAAAAAAAATGAGCTGGG + Intergenic
1197315341 X:124959055-124959077 TTCCTTTAAAATAATGAGTTAGG + Intronic
1197381247 X:125743794-125743816 GGCCTCAAAAATAATGGCCTGGG + Intergenic
1197398554 X:125959580-125959602 ATCCTTAAATACAATGAGCTTGG - Intergenic
1198201864 X:134429507-134429529 TGCCATAAAAATATGGAGATGGG + Intergenic
1198380659 X:136080262-136080284 GTTTTTAAAAATAATGAGCTGGG + Intergenic
1198701661 X:139403409-139403431 TGCTTAAAAAATAATGAGAATGG - Intergenic
1199667380 X:150109112-150109134 TGGCCTAAAATTAATGACCTAGG - Intergenic
1201334527 Y:12865896-12865918 TGCATTTAAAATAATGAGGTTGG + Intergenic
1201850054 Y:18470119-18470141 TTCCTTTAAAATAATAAACTGGG + Intergenic
1201883264 Y:18850258-18850280 TTCCTTTAAAATAATAAACTGGG - Intergenic
1202140790 Y:21719843-21719865 TGCCTTAAAAATAATCTTCTTGG + Intergenic
1202146075 Y:21783954-21783976 TGCCTTAAAAATAATCTTCTTGG - Intergenic