ID: 958782082

View in Genome Browser
Species Human (GRCh38)
Location 3:98554819-98554841
Sequence TGGATTGGTCTAAAACAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958782075_958782082 1 Left 958782075 3:98554795-98554817 CCAGGTCGCCATACATAATATCC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 958782082 3:98554819-98554841 TGGATTGGTCTAAAACAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 92
958782077_958782082 -7 Left 958782077 3:98554803-98554825 CCATACATAATATCCCTGGATTG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 958782082 3:98554819-98554841 TGGATTGGTCTAAAACAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 92
958782074_958782082 4 Left 958782074 3:98554792-98554814 CCACCAGGTCGCCATACATAATA 0: 1
1: 0
2: 0
3: 2
4: 40
Right 958782082 3:98554819-98554841 TGGATTGGTCTAAAACAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958782082 Original CRISPR TGGATTGGTCTAAAACAGGT AGG Intronic
904009924 1:27383498-27383520 GGGCTTGGACTAAAGCAGGTGGG + Intergenic
912116545 1:106414267-106414289 TGGATTGTTCTAAAGCTAGTTGG - Intergenic
1068888582 10:62124648-62124670 TGGATTAGATTAAAAGAGGTAGG - Intergenic
1071964192 10:90835514-90835536 GGTCTTGGTATAAAACAGGTAGG - Intronic
1076713400 10:132351278-132351300 GGCATTGGTCTCAAGCAGGTCGG + Intronic
1080634598 11:34112595-34112617 TGCATTGGTCTATATCCGGTTGG - Intronic
1084995681 11:72975477-72975499 TGGTATATTCTAAAACAGGTAGG + Intronic
1087341052 11:96907728-96907750 TGGAATGGTCAAAAACAGTGAGG + Intergenic
1095428307 12:42103424-42103446 TGGATCTGTATAAAACAGTTTGG + Intronic
1096751916 12:53765148-53765170 TGGATTGGTCTACATCAGAATGG + Intergenic
1099536440 12:83851371-83851393 TGGCTTTGTCTAAAATAAGTTGG + Intergenic
1104304171 12:127594321-127594343 TGGTTTGGTCTAAAAAGGGTGGG + Intergenic
1106956446 13:34943049-34943071 TTGATTGGACTCATACAGGTCGG + Exonic
1108639240 13:52366996-52367018 TGGAATGGGCTAAAAGAGATAGG + Intergenic
1110082357 13:71331368-71331390 TGGATTGGATTTAAACAGGTTGG + Intergenic
1110910128 13:80949771-80949793 TAAATTGATCTAAAAGAGGTTGG + Intergenic
1117513247 14:56473629-56473651 TGGATTTGGGTAGAACAGGTGGG - Intergenic
1118443805 14:65834379-65834401 TGGGCTGGTCTCACACAGGTCGG - Intergenic
1119092308 14:71796083-71796105 TGGATATGTCAAAAAAAGGTGGG + Intergenic
1128440438 15:67702890-67702912 TAGATTGGTCTGGAACAGGAGGG - Intronic
1129003203 15:72351019-72351041 TATATTGGTCTAAAACTGGCTGG + Intronic
1131353432 15:91722405-91722427 TGGATTGCCCTAAAAGAGGGTGG - Intergenic
1137343506 16:47633712-47633734 TGGAGTACTCTAAAACAGATGGG + Intronic
1139401028 16:66681709-66681731 TGGATTTTTCTAAAAGAGATGGG - Intronic
1141662999 16:85451813-85451835 TGCACTGCTCTAAAACAGGAAGG - Intergenic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144864030 17:18323502-18323524 TGGTTTGGTGGAAAACAGGAGGG + Intergenic
1145331449 17:21875791-21875813 TGGAATGGTCTCAAACAGAATGG + Intergenic
1147337023 17:39732575-39732597 TGGATTGACCAGAAACAGGTGGG - Intergenic
1149026583 17:52034610-52034632 TGGATTGGACTCAGACAGCTTGG - Intronic
1150725355 17:67647208-67647230 TGGATTGGCCAAAAGCAGCTTGG + Intronic
1151085901 17:71380319-71380341 TGGCTTGGTCAAAAAGAGGTTGG - Intergenic
1152218803 17:79049579-79049601 AGGATTAGTCAAAACCAGGTGGG - Exonic
1155670681 18:28367382-28367404 TGGATTCGTATAAAACCTGTGGG - Intergenic
1157164187 18:45343092-45343114 TGGATAGGACTAACTCAGGTAGG - Intronic
1157526732 18:48388866-48388888 TTGATTGATCTAGAACAAGTAGG + Intronic
1158638582 18:59182580-59182602 TTCATTGGTCTAAAAAAGTTTGG - Intergenic
1159228435 18:65572283-65572305 GGGAGTGGCCTAAAAGAGGTGGG - Intergenic
1159562888 18:70014715-70014737 TGGATGGGTCAAAAATAAGTTGG - Intronic
1164450812 19:28362790-28362812 TGGATTAGTCTAAAACATAACGG + Intergenic
1165402079 19:35607751-35607773 AGGATTGGTCCATGACAGGTTGG + Intergenic
934696826 2:96406024-96406046 TGGCAGGTTCTAAAACAGGTGGG + Intergenic
935041738 2:99436911-99436933 TGGAGTGGTCCAAAACTGTTAGG - Intronic
936885655 2:117308149-117308171 TGGATGTGTCTAAAGCAGGTGGG + Intergenic
936890271 2:117360872-117360894 TGGTTTTGGCTAAAACAGGCGGG - Intergenic
939622884 2:144441692-144441714 TGGCTTAGTCTAAAACACTTAGG - Intronic
942202525 2:173585871-173585893 GGGAATGGTCTTAAACAAGTTGG + Intergenic
947934656 2:233993557-233993579 TGGACTGTACAAAAACAGGTGGG + Intronic
1171215467 20:23349480-23349502 TGGATTGATCTAAATCAGCGTGG - Intergenic
1173157399 20:40625784-40625806 TGGATTGGTTAAATACATGTTGG - Intergenic
1176517914 21:7800037-7800059 CGGAGTGATCTAAAACAGGCGGG - Intergenic
1177334264 21:19702968-19702990 TTGATTGGTGTAATACAAGTTGG + Intergenic
1178651942 21:34430050-34430072 CGGAGTGATCTAAAACAGGCGGG - Intergenic
1181771974 22:25132118-25132140 TGCATTGATTTAAAACAAGTGGG - Intronic
1184261108 22:43316908-43316930 TGGGTTGGACAAAAACAGGCAGG + Intronic
949756436 3:7416469-7416491 TGGATTAATCTACAACATGTGGG - Intronic
952624192 3:35383955-35383977 TGCATTGGTGAAAAACAAGTAGG + Intergenic
957911540 3:86625057-86625079 TGGTTTGGCCCAAAAAAGGTGGG + Intergenic
958271874 3:91509895-91509917 TGGATTCAACTAAAACAGTTTGG + Intergenic
958782082 3:98554819-98554841 TGGATTGGTCTAAAACAGGTAGG + Intronic
963987287 3:151611110-151611132 TGGATTGTTATAAATCAAGTTGG + Intergenic
965099758 3:164280036-164280058 GTTATTGGTCTTAAACAGGTGGG + Intergenic
965293831 3:166917629-166917651 TGGAATGGTCACCAACAGGTGGG - Intergenic
966629848 3:182060167-182060189 TGGCTTGTTCTGATACAGGTGGG - Intergenic
979479876 4:121204376-121204398 TGGTTTGGTCTGAAAAAGGCAGG - Intronic
980019943 4:127696957-127696979 TTTATTGGTCTAAAACAGTGAGG - Intronic
982138381 4:152294468-152294490 TGGATTGATACAAAACAGGGAGG + Intergenic
983850727 4:172577394-172577416 TAAATTTGTATAAAACAGGTTGG - Intronic
987082189 5:14435798-14435820 AGGAGTGCTCTAAAACAAGTTGG - Intronic
987624037 5:20374595-20374617 TGAATTGGTCTAAAATATGCCGG - Intronic
996612819 5:125404150-125404172 TGGAGCCGTGTAAAACAGGTTGG - Intergenic
996968833 5:129338700-129338722 TGGAATGGCATAAAAGAGGTGGG - Intergenic
999594744 5:153190374-153190396 TGGATTGGACCAAAAGAGGAAGG - Intergenic
1005560502 6:27035462-27035484 TTGATGGGTTTAAAGCAGGTAGG - Intergenic
1007794099 6:44333652-44333674 TGTATTGTTCTAACACAGGGAGG - Intronic
1008983240 6:57511238-57511260 TGGATTCAACTAAAACAGTTTGG - Intronic
1009171296 6:60404105-60404127 TGGATTCAACTAAAACAGTTTGG - Intergenic
1019565574 7:1677269-1677291 TGGATTGGTATGAAACAGTGGGG + Intergenic
1020450317 7:8314590-8314612 TGGCTTTGGCTAAAGCAGGTGGG + Intergenic
1022702854 7:32777681-32777703 AGGATAAGTCTAAAACAGTTTGG + Intergenic
1022981902 7:35611990-35612012 TGGCTTGGCCTAAAAAAGGCAGG + Intergenic
1022987935 7:35678183-35678205 TGGATGCTGCTAAAACAGGTTGG + Intronic
1030686347 7:112490969-112490991 TGGATTGATCAAAAACATTTGGG + Exonic
1034703034 7:153113349-153113371 TAGATTGGTCTTTAACAGATAGG + Intergenic
1034867804 7:154656649-154656671 TGGATTGGACCAAGACCGGTAGG + Intronic
1037600425 8:20389289-20389311 TGAAATGGTCAAAAACAAGTTGG - Intergenic
1046875254 8:119247861-119247883 TGGATGTGTCTAACACAGGCTGG + Intergenic
1049654969 8:143793332-143793354 TGGTTTTGTCTAAAAAAGGCAGG + Intronic
1051416540 9:16846736-16846758 TGGATTGGTCTAAAATAATTTGG - Intronic
1051510005 9:17867390-17867412 GGGATTGCTCTAATAGAGGTGGG + Intergenic
1060712104 9:125877333-125877355 TAGATTTGTCTAAAACAAGTGGG - Intronic
1061522837 9:131131142-131131164 TGGAATGGACTGAAAAAGGTGGG - Intronic
1187799676 X:23047256-23047278 TGGAATCTTTTAAAACAGGTAGG + Intergenic
1187887284 X:23901423-23901445 TGGTTTGGTTTTGAACAGGTTGG - Intronic
1191612728 X:63134451-63134473 TGGTTAGGTCCAAAAAAGGTGGG - Intergenic
1191623569 X:63244475-63244497 TGGTTAGGTCCAAAAAAGGTGGG + Intergenic
1197328790 X:125127739-125127761 TGAAGTGATCTAAAACAGGAGGG - Intergenic
1199411345 X:147527602-147527624 AAGATTGGTCTAAAAGAAGTAGG + Intergenic
1201212286 Y:11691580-11691602 TGGACTGGTCTCAAACAGAATGG + Intergenic