ID: 958789683

View in Genome Browser
Species Human (GRCh38)
Location 3:98637027-98637049
Sequence TGTCTAAGGCTGAGAGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958789683_958789688 5 Left 958789683 3:98637027-98637049 CCCCCTACTCTCAGCCTTAGACA No data
Right 958789688 3:98637055-98637077 TCTAGACAGAAAAGCAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958789683 Original CRISPR TGTCTAAGGCTGAGAGTAGG GGG (reversed) Intergenic
No off target data available for this crispr