ID: 958790678

View in Genome Browser
Species Human (GRCh38)
Location 3:98647480-98647502
Sequence CCTTATAAGAAGAGGAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3138
Summary {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958790678_958790684 0 Left 958790678 3:98647480-98647502 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 958790684 3:98647503-98647525 ACTCCAGTCAGGTTGGATTAGGG No data
958790678_958790682 -7 Left 958790678 3:98647480-98647502 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 958790682 3:98647496-98647518 TATAAGGACTCCAGTCAGGTTGG No data
958790678_958790683 -1 Left 958790678 3:98647480-98647502 CCAGATTTCCTCTTCTTATAAGG 0: 9
1: 140
2: 478
3: 958
4: 1553
Right 958790683 3:98647502-98647524 GACTCCAGTCAGGTTGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958790678 Original CRISPR CCTTATAAGAAGAGGAAATC TGG (reversed) Intergenic
Too many off-targets to display for this crispr