ID: 958790678 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:98647480-98647502 |
| Sequence | CCTTATAAGAAGAGGAAATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3138 | |||
| Summary | {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 958790678_958790684 | 0 | Left | 958790678 | 3:98647480-98647502 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
| Right | 958790684 | 3:98647503-98647525 | ACTCCAGTCAGGTTGGATTAGGG | No data | ||||
| 958790678_958790682 | -7 | Left | 958790678 | 3:98647480-98647502 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
| Right | 958790682 | 3:98647496-98647518 | TATAAGGACTCCAGTCAGGTTGG | No data | ||||
| 958790678_958790683 | -1 | Left | 958790678 | 3:98647480-98647502 | CCAGATTTCCTCTTCTTATAAGG | 0: 9 1: 140 2: 478 3: 958 4: 1553 |
||
| Right | 958790683 | 3:98647502-98647524 | GACTCCAGTCAGGTTGGATTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 958790678 | Original CRISPR | CCTTATAAGAAGAGGAAATC TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||