ID: 958795013

View in Genome Browser
Species Human (GRCh38)
Location 3:98698086-98698108
Sequence GGGAACAATTAGAAAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958795010_958795013 15 Left 958795010 3:98698048-98698070 CCAGCAAAGAATTGAAGGTGTTA No data
Right 958795013 3:98698086-98698108 GGGAACAATTAGAAAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958795013 Original CRISPR GGGAACAATTAGAAAACTGC AGG Intergenic
No off target data available for this crispr