ID: 958798681

View in Genome Browser
Species Human (GRCh38)
Location 3:98732698-98732720
Sequence GGCGCAGTCGCCCGGGATTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958798670_958798681 18 Left 958798670 3:98732657-98732679 CCGCGGAGCAGGAGGAGCTTCCC 0: 1
1: 0
2: 3
3: 25
4: 216
Right 958798681 3:98732698-98732720 GGCGCAGTCGCCCGGGATTGGGG 0: 1
1: 0
2: 0
3: 4
4: 56
958798673_958798681 -2 Left 958798673 3:98732677-98732699 CCCGCGACTCCGGAGGCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 958798681 3:98732698-98732720 GGCGCAGTCGCCCGGGATTGGGG 0: 1
1: 0
2: 0
3: 4
4: 56
958798669_958798681 22 Left 958798669 3:98732653-98732675 CCAGCCGCGGAGCAGGAGGAGCT 0: 1
1: 0
2: 3
3: 29
4: 207
Right 958798681 3:98732698-98732720 GGCGCAGTCGCCCGGGATTGGGG 0: 1
1: 0
2: 0
3: 4
4: 56
958798675_958798681 -3 Left 958798675 3:98732678-98732700 CCGCGACTCCGGAGGCGCTCGGC 0: 1
1: 0
2: 0
3: 4
4: 39
Right 958798681 3:98732698-98732720 GGCGCAGTCGCCCGGGATTGGGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958798681 Original CRISPR GGCGCAGTCGCCCGGGATTG GGG Exonic
900950032 1:5853356-5853378 GGAGCAGTGGCTCGGGCTTGGGG + Intergenic
901204150 1:7484264-7484286 GGCTCAGTCTCCTGGGACTGGGG - Intronic
904578770 1:31524070-31524092 GGCGGAGGCACCCGGGCTTGTGG + Intergenic
915589903 1:156864787-156864809 GGCTCAGTCGCCTGTGAGTGTGG + Exonic
921029798 1:211327063-211327085 GGCGGAGGGGCCCGGGCTTGCGG + Intronic
1076315004 10:129533776-129533798 GAAGCAGTGGCCCGGGATGGTGG + Intronic
1076469983 10:130711554-130711576 GCCGCAGTCGCCCAGGACAGGGG - Intergenic
1084837565 11:71813787-71813809 GGCGCAATCGCCCTGGCTTTGGG - Intergenic
1089173198 11:116529842-116529864 GGTGCCGTCGGCCTGGATTGTGG - Intergenic
1090890208 11:130916404-130916426 AGCGCAGTCGCCCAGGTTTACGG - Exonic
1091776075 12:3185720-3185742 GGGGCAGCCGCCTGGGCTTGGGG + Intronic
1099182856 12:79487346-79487368 GGCGTAGTCCCCAGGGTTTGAGG - Intergenic
1104965095 12:132505416-132505438 GGGGCAGTCCCCAGGGACTGAGG - Intronic
1105821503 13:24085026-24085048 TTCGCAGTCGCCTGGGATTCTGG + Intronic
1110318392 13:74134934-74134956 GGCGGAGCCGGCCGGGACTGTGG + Intergenic
1129334267 15:74843099-74843121 GGCGCAGGCGGCCGGAATGGCGG - Exonic
1131256583 15:90866679-90866701 GGCTCAGTCGCCCCTGAGTGTGG - Intergenic
1136382023 16:29900274-29900296 TGGGCAGGCGCCCGGGACTGCGG - Intergenic
1139539164 16:67601084-67601106 AGCGCAGTCCCCAGGGAGTGGGG + Intronic
1143411730 17:6713403-6713425 GCCACAGTCCCCGGGGATTGGGG + Exonic
1146574498 17:33979346-33979368 GGGGCAGTTGCCAGGGAGTGAGG + Intronic
1151228326 17:72663478-72663500 GGAGCAGGAGCCCAGGATTGAGG - Intronic
1161215650 19:3094135-3094157 GGCGGGGCCGCCCGGGATTGTGG - Intergenic
1161304150 19:3557597-3557619 GGCGCAGTCGCCCGGCTCTGGGG - Intronic
1161379935 19:3959577-3959599 GGCGCCGCCGCTCGGGCTTGCGG + Exonic
1163761162 19:19137576-19137598 GGCACAGGCTCCCGGGAATGAGG - Intronic
1165375800 19:35440816-35440838 GTTGCAGTCGCCAGGGGTTGAGG - Intergenic
926055452 2:9771468-9771490 GGCGCTGTCACCTGGGTTTGAGG + Intergenic
932779175 2:74549326-74549348 GGCGGAGCAGGCCGGGATTGGGG - Intronic
948507031 2:238435344-238435366 AGCGCACTCGCCCGGGAGTCTGG - Intronic
1172714186 20:36951117-36951139 GGAGCAGGCTCCCGGGATTGAGG - Intronic
1176619145 21:9043123-9043145 GGCGCAGGCGCCGGGGGGTGGGG - Intergenic
1179608797 21:42535629-42535651 TGCACAGGCGCGCGGGATTGAGG + Intronic
1181804954 22:25369216-25369238 GGCGGAGTCTCCAGGGAGTGTGG + Intronic
1183095426 22:35549139-35549161 GGGGCAGGAGCCTGGGATTGGGG - Intronic
1185058140 22:48591875-48591897 GGCCCAGGCGCCCGGGATGCTGG - Intronic
950040326 3:9915819-9915841 GCCGCAGACACCCGGGACTGCGG - Exonic
956382130 3:68675584-68675606 GGCTCAGTCAGCCAGGATTGTGG + Intergenic
958798681 3:98732698-98732720 GGCGCAGTCGCCCGGGATTGGGG + Exonic
961380085 3:126491437-126491459 GGCGCACTCGCCCCGGGCTGCGG - Intronic
963835842 3:150057088-150057110 AGCGCAGTCCTCCTGGATTGGGG + Intergenic
964452595 3:156826318-156826340 GGCGCGGTCGCCCGGGAGACCGG + Intronic
965566713 3:170127226-170127248 GGTGCAGTGGGCCGAGATTGCGG - Intronic
975512065 4:75205173-75205195 GCCACAGTCACCCTGGATTGGGG + Intergenic
985791471 5:1930775-1930797 GGCGCAGTGGCCCCGGAGCGTGG + Intergenic
986281304 5:6325040-6325062 GCTGCAGTGGCCCGAGATTGTGG + Intergenic
990456620 5:55995015-55995037 GGCGCAGCTGGGCGGGATTGGGG - Intergenic
1002412812 5:179096707-179096729 GGCTCAGACTCCTGGGATTGAGG + Intergenic
1003357439 6:5386860-5386882 GGCACAGTCGCCTGGGGTGGAGG + Intronic
1003589634 6:7426021-7426043 CGCGCAGAAGCCCGGGATTGGGG - Intergenic
1010715911 6:79229843-79229865 GGCTCAGTCGCCCAGGCTGGAGG - Intronic
1016394854 6:143613011-143613033 TGCTCTGTCGCCCGGGAGTGCGG + Intronic
1023740999 7:43280471-43280493 GTCTCAGTGGCCTGGGATTGAGG - Intronic
1024094677 7:45974305-45974327 GGCTCAGCCTCCCGGGATGGGGG + Intergenic
1028997079 7:97112955-97112977 GGCTCTGTCGCCCAGGATGGAGG + Intergenic
1033802851 7:144920975-144920997 GTGGCAGTCAGCCGGGATTGTGG + Intergenic
1034413012 7:150950977-150950999 GGCGCTGGCGCAGGGGATTGGGG + Exonic
1039873615 8:41567408-41567430 GGCGCAGCAGCCCGGGCGTGGGG - Intergenic
1045620279 8:103969778-103969800 CGCTCAGTCGCCCAGGATGGAGG + Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1051445588 9:17135601-17135623 GGGGCAGGGGCCCGGGTTTGGGG - Intronic