ID: 958805017

View in Genome Browser
Species Human (GRCh38)
Location 3:98799718-98799740
Sequence TCCTGCCCTGGTGAGTTGTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958805012_958805017 17 Left 958805012 3:98799678-98799700 CCCCGTAATTGGGAGTGGTTCAG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 958805017 3:98799718-98799740 TCCTGCCCTGGTGAGTTGTAAGG 0: 1
1: 0
2: 2
3: 9
4: 137
958805014_958805017 15 Left 958805014 3:98799680-98799702 CCGTAATTGGGAGTGGTTCAGCA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 958805017 3:98799718-98799740 TCCTGCCCTGGTGAGTTGTAAGG 0: 1
1: 0
2: 2
3: 9
4: 137
958805013_958805017 16 Left 958805013 3:98799679-98799701 CCCGTAATTGGGAGTGGTTCAGC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 958805017 3:98799718-98799740 TCCTGCCCTGGTGAGTTGTAAGG 0: 1
1: 0
2: 2
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958805017 Original CRISPR TCCTGCCCTGGTGAGTTGTA AGG Exonic
901138889 1:7015166-7015188 TGCTGTCCTGGTGAGCTGCATGG + Intronic
901231907 1:7646242-7646264 CCCTGCCCTGGTGAGTTGGATGG + Intronic
903129031 1:21266319-21266341 TCCTGCCCTGGTGTGGAGTCAGG - Intronic
903974018 1:27137650-27137672 TCGTGGCCTGGGGAGTTGTCAGG - Intronic
913697669 1:121343470-121343492 TCCTACCCAGGTTAGATGTAAGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914940784 1:152021297-152021319 TCCTGCCCCTGGGAGTTGTCAGG - Intergenic
916727740 1:167538088-167538110 TCCTGCCTTGGTGTGTTGCGGGG + Intronic
917512671 1:175681232-175681254 TCCTGCACTGATGCGTTGTTGGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
1063679296 10:8171918-8171940 TCCTGCCCTGGTGAGCTAGCAGG + Intergenic
1066360181 10:34722580-34722602 TCCTGCCCTGGAGAGTGAGACGG - Intronic
1066643285 10:37578380-37578402 TCCTGACCTCGTGATTTGCATGG - Intergenic
1072686576 10:97541003-97541025 TGCTGCCCTGGGGAGTTGGTAGG + Intronic
1075707726 10:124511844-124511866 GCGTGCCCTGGTGAGTGGTGGGG + Intronic
1075915487 10:126162676-126162698 TCCTGGCCTGGTGCTCTGTATGG - Intronic
1077538561 11:3135834-3135856 TCCTGCCCTGCTGAGTTTCCTGG + Intronic
1079960456 11:26917131-26917153 AGCTGCCCTGGAGAGTTGTCTGG + Intergenic
1085488588 11:76891407-76891429 TCCTGCCTTGGTCAGGTGAAAGG - Intronic
1088691641 11:112333418-112333440 CCCTGCCCTGGGTTGTTGTAAGG + Intergenic
1088714515 11:112537108-112537130 TCCTCTCCGGGGGAGTTGTATGG - Intergenic
1089067207 11:115670889-115670911 TCCTGCCCTTGTCAGCTCTAGGG + Intergenic
1095597652 12:43977699-43977721 GCCTGCCCTTGAGAGTTATATGG + Intronic
1095909192 12:47408602-47408624 GCCTGCCCTGGTGACTGGGAAGG - Intergenic
1096808717 12:54156303-54156325 TCCTCACCTGCTGTGTTGTAAGG + Intergenic
1097966215 12:65584266-65584288 TCCTACCCTGGGGATTAGTAAGG + Intergenic
1104582123 12:130018743-130018765 CCCTTCCCTGGGGAGGTGTAAGG - Intergenic
1104717586 12:131026281-131026303 TCCTGCCCTTCTGAGCTGGATGG + Intronic
1105614714 13:22001271-22001293 TTCTGCCCAGATGAGTTGGAGGG + Intergenic
1106077948 13:26476784-26476806 TCATGCCTTGGTGAGCTCTATGG - Intergenic
1113781039 13:112977663-112977685 TCCTTCCCTTGTGCGTGGTAAGG - Intronic
1116774420 14:49163917-49163939 TTCTGCCTTGGTGTGTTCTAAGG + Intergenic
1117148731 14:52863125-52863147 TGCTGCCCTGGGGAACTGTATGG - Intronic
1118289176 14:64504410-64504432 TCCTGCCCTGGGGAGTCGGGAGG + Intronic
1122003652 14:98684730-98684752 TCCTGCCCTGGAGGGGTGTGGGG + Intergenic
1122846145 14:104500268-104500290 TCCTGTCCTGGTCAGTTGGAAGG - Intronic
1124130946 15:26985186-26985208 TCCTGCCCAGGTGGGGTGTGTGG - Intronic
1125003095 15:34792077-34792099 TCCTTCATTGGTGAGTTGTAGGG - Exonic
1125540901 15:40469592-40469614 GCCTGCCCTGGAGAGCTGGAAGG + Intergenic
1127401446 15:58590348-58590370 CCCTGCCCTGGTGAAGCGTATGG - Exonic
1129166194 15:73779465-73779487 CCCTGCTCTGGTAAGCTGTAAGG + Intergenic
1132857542 16:2053533-2053555 TCCTGCCTCGGTGAGTTGCTGGG + Intronic
1133116540 16:3580841-3580863 TGCTGTCTTGGTGAGTTGTGGGG + Intergenic
1137676692 16:50307138-50307160 TCATGCCCAGGTCAGTTGCAGGG + Exonic
1138051296 16:53781507-53781529 TCCTGCCTTGGAGATGTGTAGGG + Intronic
1140298220 16:73729224-73729246 GCCGGCCCAGGTGTGTTGTAAGG - Intergenic
1141107715 16:81247284-81247306 TCCTCCCCTGGAGAGCTGTTGGG + Intronic
1141458292 16:84159529-84159551 TCCTGTCCTGGTGACTTGATGGG - Intronic
1142156753 16:88535801-88535823 CCCTGCCCTGCTGGGCTGTATGG + Exonic
1143159637 17:4860735-4860757 TTCTCCCCTGGTCAGTTCTAGGG + Intronic
1143168483 17:4911478-4911500 TCCTGTACTGGTAAGTTGCAAGG - Intergenic
1144046186 17:11456682-11456704 TCCAGCCCTGGTGAGGGCTAAGG - Intronic
1144640012 17:16931833-16931855 GCCTGCCCTGGTGAGATCTGAGG - Intronic
1145032032 17:19511625-19511647 TCCTGCCCTGATTAGTTGTGTGG + Intronic
1145271033 17:21405078-21405100 TCCTGCCCTTGTGCGTTTTGTGG + Intronic
1145309236 17:21692465-21692487 TCCTGCCCTTGTGCGTTTTGTGG + Intergenic
1145368499 17:22286726-22286748 TCCTGCCCTGGCAACTTGGAAGG - Intergenic
1145771576 17:27497007-27497029 TCCTGCTCTGGTGTTTTCTAGGG + Intronic
1147968816 17:44208668-44208690 ACCTGCCTTGGTGAGTGGGAAGG + Intronic
1148838530 17:50479478-50479500 ACCTGCCTTGGGGAGTTGTGTGG + Intronic
1149295136 17:55255154-55255176 TCCTGTCCTGGTCAGATGAATGG - Intergenic
1149355592 17:55835910-55835932 TCCTGCCCTGGAGATTTGGAAGG + Intronic
1150528640 17:65953692-65953714 TACTTCCCTGGTGACCTGTATGG + Intronic
1151546700 17:74797717-74797739 CCCTCCCTTGGTGAGTTGGAAGG + Intronic
1152488577 17:80613072-80613094 CCCTGCCCTGGTGTGATGTGTGG + Intronic
1153994070 18:10424381-10424403 ACCTGCCCTGGTGAGGAGGATGG + Intergenic
1155412504 18:25562027-25562049 TTCTGCCCTAGTGGATTGTAGGG - Intergenic
1157348108 18:46858880-46858902 TCTTGTCCTGGTGAGTAGCATGG - Intronic
1158412883 18:57223159-57223181 TCCTGCCCTGCAGAGTCGTCTGG - Intergenic
1159735728 18:72095128-72095150 TCCTGACCTTGGGAGTTATAAGG + Intergenic
1160791561 19:925942-925964 TCGTCCCCTGGTGATTTGTCTGG + Intronic
1162179296 19:8856338-8856360 TCCTGACCTCGTGATTTGTATGG - Intronic
1165130299 19:33627860-33627882 CCCTGCCCTTGTGAGTTAGATGG + Intronic
926092001 2:10057477-10057499 TCCTGCTCTGCTGTGTTCTAAGG + Exonic
932863149 2:75315392-75315414 TCCTGCCTTGCTGAATTGTTTGG - Intergenic
933124592 2:78588390-78588412 TCCTGTCTTTGTGAGTGGTAGGG - Intergenic
935624844 2:105163625-105163647 TCCTACCCTTCTGAGTTATATGG + Intergenic
937035016 2:118773796-118773818 TCCTGCCTTGCTCAGTTGTACGG - Intergenic
944118225 2:196211777-196211799 TTCTGCCCTGGAGGGTTGGAGGG - Intronic
946822241 2:223642292-223642314 CCCTACCCTGGTGACTTGAATGG - Intergenic
1169114289 20:3053058-3053080 TCCTGACCTGGTGATATTTAAGG + Intergenic
1170447215 20:16440615-16440637 TTCTGCCCTGGTGAGTCCTGTGG - Intronic
1170948630 20:20913941-20913963 TACTGCCATGGTGAGTTGTAGGG - Intergenic
1175746345 20:61459851-61459873 TCCTGCCCTGGGGTGGTGTGTGG - Intronic
1175771151 20:61625134-61625156 TCCCGCCCTGGTGAGTTTTGTGG - Intronic
1179660727 21:42873158-42873180 GCCTGCCCTGGAGAGTGATAGGG - Intronic
1185040758 22:48502990-48503012 TCCTGCCCTGCAGAGGTGGAAGG + Intronic
950738936 3:15034228-15034250 TCCTGCCCTGCAGGGTTGCAGGG + Intronic
953119895 3:40029729-40029751 TCCTTTACTGGTGTGTTGTAAGG - Intronic
955323447 3:57991628-57991650 TTCTGCATTGATGAGTTGTACGG - Intergenic
955987096 3:64584885-64584907 TCCTGACTTAGAGAGTTGTACGG - Intronic
956774839 3:72556396-72556418 ACTTGCCATGGTGAATTGTAGGG - Intergenic
958805017 3:98799718-98799740 TCCTGCCCTGGTGAGTTGTAAGG + Exonic
961838891 3:129690749-129690771 AGCTGCCCTGGAGAGTTGTCTGG + Intronic
967452836 3:189646262-189646284 CCCTCCCCTTGTCAGTTGTATGG - Intronic
968952495 4:3702232-3702254 TCCTGCCCTCGGGAGATGTGTGG - Intergenic
969994263 4:11295349-11295371 TCCTGGCCTCGGGAGGTGTATGG + Intergenic
972884650 4:43470804-43470826 GCCTGTCCTTGTGAGTTATATGG - Intergenic
974681359 4:65167808-65167830 TCCTGCCATGTTGAGTTTTAGGG + Intergenic
975207724 4:71663758-71663780 TGCTGCCCTGGTGATTTGGATGG + Intergenic
976318628 4:83686330-83686352 CACTGCCCTGATGAGTTGTGTGG + Intergenic
976647827 4:87403604-87403626 GCCTGTCCTTGTGAGTTATATGG + Intergenic
978306392 4:107333216-107333238 GCCTGTCCTTGTGAGTTATATGG - Intergenic
978678591 4:111350322-111350344 TACTGCACTGCTGAGTGGTAGGG + Intergenic
981582108 4:146260426-146260448 TCCTGCTCTGGTCATTTTTAGGG - Intronic
982312399 4:153999803-153999825 TACTGCACTGGAGAGTTGTGAGG + Intergenic
982685597 4:158485041-158485063 TCCTGCTCTAGGAAGTTGTAGGG - Intronic
987593364 5:19962884-19962906 TCCTGCCTTGGTGAATTAGATGG - Intronic
993666750 5:90707872-90707894 AGCTGCCCTGGGGAGTGGTAGGG + Intronic
995847349 5:116508546-116508568 TCCTGCCCTGGAAAATTCTACGG + Intronic
997600696 5:135136427-135136449 CCCTTCCCTGGTGATCTGTAAGG - Intronic
999421963 5:151452207-151452229 TTCTGCTCTGGTAAGTTGGATGG + Intronic
1002994643 6:2271397-2271419 TCCTGCCATGGTGAGAAGTGGGG - Intergenic
1004641386 6:17519260-17519282 TGCTGCCCTGTTCAGTTGTCAGG + Intronic
1005582783 6:27250303-27250325 TCCTAACCTGATGAGTTGCAAGG - Intronic
1006168443 6:32079531-32079553 TCCTGCTCTGGTGGGTTCTGTGG + Intronic
1013233165 6:108175105-108175127 TCTTGCCCTGGGGAATTCTAGGG - Intronic
1013939389 6:115643900-115643922 TCCTGCCATGGCCAGTTGAAAGG - Intergenic
1015252308 6:131139841-131139863 TCCTGGTTTGGTGAATTGTATGG + Intronic
1018013382 6:159692357-159692379 GCCAGCACTGGTGAATTGTAGGG - Intronic
1019485100 7:1285699-1285721 TCCTGCCCTGGGGTGTGGGAAGG + Intergenic
1019660931 7:2223650-2223672 TCCAGCCCTTGTGAGCTGCAAGG + Intronic
1020546966 7:9544251-9544273 TTCTCTCCTGGTAAGTTGTAAGG - Intergenic
1024800942 7:53077249-53077271 TCCTGCCCTGTTGGGATCTATGG - Intergenic
1026266721 7:68801771-68801793 ACATGCCTTGGGGAGTTGTAAGG + Intergenic
1027285140 7:76639431-76639453 TCCTTCCCTGTGGAGTTGCAGGG - Intergenic
1029823868 7:103170312-103170334 TCCTGCTCTGATGAGTTGACAGG + Intergenic
1030731695 7:112997702-112997724 TCCTCTCCTGGTGAGTTTTCTGG - Intergenic
1034201739 7:149287037-149287059 TTCTGCCTTGGTGATTTCTAAGG - Intronic
1038714033 8:29975741-29975763 TCCTTCCCTGGTGCGTGGTTGGG - Intergenic
1039535987 8:38313272-38313294 TACTGCCCTGGTGAATAGGATGG - Intronic
1044630489 8:94273716-94273738 TGCTGCCCTGCTGAGTTTCATGG + Intergenic
1047571010 8:126098716-126098738 GCCTGCCCTGTTGTGTTATATGG - Intergenic
1048834766 8:138508697-138508719 TCCTGCAGTGGTGTGTTGTCAGG - Intergenic
1048867441 8:138771196-138771218 TCATCCCCTGGTGAGGTGCAGGG - Intronic
1049247291 8:141569636-141569658 TGCTGGCCTGGTGGGGTGTAGGG + Intergenic
1052794990 9:32915382-32915404 ACTTGCCTTGGTGAGTTGGATGG + Intergenic
1053833765 9:42111890-42111912 TTCTGCTCTGGTGATATGTAAGG - Intronic
1054596788 9:67075520-67075542 TTCTGCTCTGGTGATATGTAAGG + Intergenic
1058384489 9:104418197-104418219 TGCTACCCTGGTGAGTTGGCTGG - Intergenic
1060346385 9:122820270-122820292 TCCTGCCCTGCTGATCTATAAGG - Exonic
1189717000 X:43877319-43877341 ACCTGCCCTGGTGACTTCTGAGG + Intronic
1190148467 X:47920343-47920365 TGCTGACCTGGTGAGTTGGGGGG + Exonic
1194655559 X:96569294-96569316 TCCTGCACTGGTTTGTTGTGTGG - Intergenic
1197063683 X:122213439-122213461 TCTTTGCCTGGTGAGTTTTATGG + Intergenic
1197890861 X:131268874-131268896 TCCTTCCCTTGAGAGTTGCAAGG + Intergenic
1198344445 X:135745984-135746006 GCCTGTCCTTGTGAGTTATATGG - Intergenic
1201790405 Y:17833693-17833715 TGCAGCCATGGTGAGTTCTATGG - Intergenic
1201811149 Y:18072296-18072318 TGCAGCCATGGTGAGTTCTATGG + Intergenic