ID: 958806337

View in Genome Browser
Species Human (GRCh38)
Location 3:98815349-98815371
Sequence GAGAAAAATAAGAAAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1951
Summary {0: 2, 1: 2, 2: 9, 3: 210, 4: 1728}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958806337 Original CRISPR GAGAAAAATAAGAAAACTGA AGG Intronic
901364219 1:8731683-8731705 GAAAAAAACAAGAAAACTACAGG + Intronic
901539297 1:9904989-9905011 CAGAGAAATAAGGAACCTGATGG + Intronic
901558632 1:10051783-10051805 GACAAAAATAAGTCATCTGATGG - Intronic
901562601 1:10084662-10084684 AAGAAAAAAAGGAAAACTAAAGG - Intronic
901891539 1:12270466-12270488 GAGAAAAAAAAGAATATAGAAGG + Intronic
902074327 1:13771022-13771044 CATAAGCATAAGAAAACTGATGG + Intronic
902124573 1:14197890-14197912 GAGAAAAATAGGGAGAATGAAGG + Intergenic
902426673 1:16329172-16329194 AAAAAAAAAAAGAAAATTGATGG + Intronic
903039522 1:20518325-20518347 GAGTAACAGAACAAAACTGAAGG + Intergenic
904086996 1:27916245-27916267 GAGAAAAAGAAAAAAAAGGAAGG - Intergenic
904522288 1:31105009-31105031 AAGAAAAAAAAGCAAACAGAGGG - Intergenic
905006130 1:34711937-34711959 GAGATAAATAAGAAGACAAAGGG + Intergenic
905383427 1:37581206-37581228 GAGGAAAATAACAGAACTAATGG + Intronic
905572030 1:39013791-39013813 AAGAAAAAAAAAAAAAATGATGG - Intergenic
905679663 1:39859601-39859623 AAGAAAGAAAAGAAAACTAAAGG + Intronic
905997202 1:42391546-42391568 CAGAAAAAGAAGGAAAGTGAAGG + Intronic
906583944 1:46959402-46959424 GAGAAAAAGAATAAAACTGGAGG + Intergenic
906691359 1:47794784-47794806 AAAAAAAAAAAAAAAACTGAAGG - Intronic
906815980 1:48879472-48879494 GACAAGAATTAGAAAAGTGAGGG + Intronic
906927151 1:50129908-50129930 GAGAAAAACAACAAATCTGAAGG - Intronic
907036866 1:51223762-51223784 GAAAAAAATTAGAAAAATGAGGG - Intergenic
907377897 1:54059141-54059163 AAAAAAAAAAAGAAAACTCAAGG - Intronic
907536883 1:55170202-55170224 AAGAAAAAATAGAAAGCTGAAGG + Intronic
908110929 1:60896644-60896666 GATAAAAATAAGGAAACAGCAGG + Intronic
908129493 1:61060692-61060714 AAAAAAAAAAACAAAACTGAGGG + Intronic
908194291 1:61733903-61733925 GAGAACAAGGGGAAAACTGAAGG - Intergenic
908277736 1:62493075-62493097 AAGAAAATTAAGAAAAATCATGG + Intronic
908290292 1:62658958-62658980 GAGAAAAAAAAAAAAAATGAAGG + Intronic
908368844 1:63458886-63458908 TAAAAAAATGAGAAAACTGCAGG - Intronic
908415746 1:63911745-63911767 GAGAAGAAACAAAAAACTGAAGG + Intronic
908448129 1:64221784-64221806 GAGTAAAATTAGATAACTTATGG + Intronic
908958452 1:69665243-69665265 GAGCAAAAGAAGGAAACTGAAGG - Intronic
908971091 1:69832593-69832615 GAAAAAACTAACAAAACCGAGGG + Intronic
909184679 1:72471329-72471351 GAGAAAAAAAAGAGAAATGGAGG + Intergenic
909239729 1:73196842-73196864 CAGAAAAATAAAAAAACTCAAGG + Intergenic
909582353 1:77252232-77252254 GAGAAAAAGAACAAAGCTGGAGG + Intergenic
909627459 1:77733483-77733505 ATGAAACATAAGAAAACTGAAGG + Intronic
909678767 1:78267823-78267845 AAGAAAAATAAGCAAATGGAAGG - Intergenic
909772916 1:79446989-79447011 GAGAAAAATGAAGAAACTGATGG + Intergenic
909794341 1:79714333-79714355 GAAAAACATAAGAAAACATAAGG - Intergenic
909871037 1:80739387-80739409 AACAAAAAGAACAAAACTGAAGG + Intergenic
909962246 1:81860839-81860861 AAGAATAAAAAGAAAACTAAAGG - Intronic
910008305 1:82427961-82427983 GAGAAACTAAAGAAAACTTAAGG - Intergenic
910419903 1:87047887-87047909 TTGAAAAATAAGAAAATTGAAGG - Intronic
910510070 1:87993547-87993569 GAATAAAATAAGAGAAGTGAAGG + Intergenic
910610844 1:89140460-89140482 GAAAAAAAAAAGAAAAATGCAGG + Intronic
910619221 1:89235083-89235105 GAGAAACATAAATAACCTGATGG - Intergenic
910696678 1:90025962-90025984 GAAAAAAAAAAAAAAAGTGAAGG - Intronic
910794746 1:91086452-91086474 GAGTAAAGGAACAAAACTGAAGG + Intergenic
910843514 1:91584137-91584159 TAGAAAAATGAGAAAAATAAAGG + Intergenic
910896683 1:92077314-92077336 TATAAAAATAAAAAAACTTAAGG - Intergenic
910994340 1:93088099-93088121 GAAAAAAATAAGAGAACTGAGGG - Intronic
911005477 1:93217228-93217250 GATAAAAATGAGAAAACGGCCGG - Intronic
911016445 1:93338139-93338161 GAGAAAAAAAAAAAAAAGGAAGG - Intergenic
911100135 1:94088924-94088946 GAGAAAATAATCAAAACTGATGG - Intronic
911148639 1:94575896-94575918 AAGAAAAAAAAGAAAACTTCTGG - Intergenic
911399316 1:97354911-97354933 ATGAAAAATAAAGAAACTGATGG - Intronic
911405204 1:97428768-97428790 CAAAAAAAAAAGAAAACTTAAGG - Intronic
911463286 1:98217561-98217583 GGGAAAGGTGAGAAAACTGAAGG - Intergenic
911793856 1:102053108-102053130 GAGCTAAACAGGAAAACTGAAGG + Intergenic
911903945 1:103541419-103541441 GAGAAAAAAGAGAAAAATAAAGG + Exonic
911909462 1:103614488-103614510 GGAAAAGATAAGAAAAATGATGG + Intergenic
911925261 1:103821780-103821802 GAGCAAAAGAGCAAAACTGAAGG + Intergenic
911925469 1:103825199-103825221 GAGCAAAAAATCAAAACTGAAGG + Intergenic
911951749 1:104182103-104182125 GAAAAAAATAAAATAACTTAAGG + Intergenic
912031486 1:105250269-105250291 AGCAAAAATAAGAAAACTGGAGG - Intergenic
912151172 1:106860536-106860558 GAGATAAAGGAGAAAGCTGATGG - Intergenic
912921388 1:113870717-113870739 GAAAAAGAAAAGAAAAATGATGG + Intronic
913194238 1:116442040-116442062 AACAAGCATAAGAAAACTGAGGG - Intergenic
913362412 1:117996667-117996689 GATTTAAATGAGAAAACTGAGGG - Exonic
913536447 1:119777555-119777577 TTGAAAAATAAGAATAATGAGGG + Intergenic
913599419 1:120408714-120408736 AAGAAAAACAAGAAAATAGATGG + Intergenic
914087961 1:144470901-144470923 AAGAAAAACAAGAAAATAGATGG - Intergenic
914310650 1:146463303-146463325 AAGAAAAACAAGAAAATAGATGG + Intergenic
914426422 1:147581362-147581384 GAGGAATTTAAGAAAACAGAGGG - Intronic
914463575 1:147907185-147907207 CCAACAAATAAGAAAACTGAAGG - Intergenic
914591455 1:149109842-149109864 AAGAAAAACAAGAAAATAGATGG - Intergenic
915026639 1:152837004-152837026 GAGAAAACCAAGGAAAGTGAGGG - Intergenic
915137756 1:153745655-153745677 GAAAAAAAAAAAAAAACTAAGGG + Intronic
915405420 1:155656451-155656473 GAGAAATTGATGAAAACTGATGG - Intergenic
915826383 1:159082477-159082499 GAGAAAGAAAAGAAAAAAGATGG - Intronic
915919629 1:159964782-159964804 GACAATAATAATAACACTGAGGG - Intergenic
916348144 1:163817976-163817998 AAGAAAAAAAAAGAAACTGAGGG + Intergenic
916531040 1:165656724-165656746 GAGCAAAATAAGGAAAATGAGGG + Intronic
916624805 1:166543687-166543709 GAGAAAAATATGTAAAATTAAGG + Intergenic
916743683 1:167667969-167667991 GAGAAAAACATGAAAAATGTGGG + Intronic
916857849 1:168769566-168769588 GCAAAAAAGAAGAAATCTGAAGG - Intergenic
916907881 1:169308421-169308443 GAGAAACATAAGAACACTATTGG + Intronic
917027048 1:170655945-170655967 GATAAAAACAAGAAAAATTAGGG + Intergenic
917069177 1:171130464-171130486 AAAAAAAATACCAAAACTGAGGG + Intergenic
917187030 1:172369165-172369187 AAGAAAAAAAAGAAAACTACAGG + Intronic
917222030 1:172742191-172742213 GGAAAAAATAGAAAAACTGATGG + Intergenic
917373289 1:174319219-174319241 GAGGAAAATTATAAAACTGATGG - Intronic
917520746 1:175746693-175746715 GAGAAAACAAAGAAGACTGAGGG + Intergenic
917611575 1:176693998-176694020 GAGAAAAGGAAGCAAACTGCAGG - Intronic
917668778 1:177251694-177251716 GAGAAACATAAGGAAACTAGAGG + Intronic
917836795 1:178947472-178947494 GAGAAAAAAAAGAAAAGAAATGG + Intergenic
918464587 1:184808377-184808399 GAGGAAAATAAGACAGTTGAAGG - Intronic
918559457 1:185847089-185847111 GTGAAAAATAAGAAATCTGATGG - Intronic
918665866 1:187150248-187150270 GAAAAAAATAAGAAAACTGAAGG - Intergenic
918777767 1:188657405-188657427 TAGAAAAGTTATAAAACTGAGGG - Intergenic
918818192 1:189219572-189219594 GAGAAAAGTAAGAAAAGCTATGG + Intergenic
918906477 1:190502859-190502881 GAGATAAGAAAGAAAACTTATGG + Intergenic
919010147 1:191949463-191949485 GACAAAAACAAGAAAACTAGAGG + Intergenic
919143901 1:193609153-193609175 GACAAAAACAAGGATACTGAAGG - Intergenic
919298053 1:195725929-195725951 GACAAAAATAAGAAAACTAGAGG + Intergenic
919438252 1:197591545-197591567 GAGAAGAATTAGAAGACTAAAGG + Intronic
919721533 1:200842250-200842272 GAGAAGAAAAAGAAAATGGAGGG + Intronic
919795652 1:201320041-201320063 GAGGAAAAGATGAAAACGGAAGG - Intronic
920126959 1:203700908-203700930 GAGAAAAAGAAGAAAGGTAAGGG + Exonic
920169506 1:204062358-204062380 CAGAAAAATAAAAAGACTAAAGG + Intergenic
920437660 1:205958402-205958424 AAAAAAAAAAAGAAAAATGATGG + Intergenic
921093630 1:211867385-211867407 GTTAAGAATAAGAAAAATGAAGG + Intergenic
921109799 1:212024145-212024167 AAGCAAACTAACAAAACTGAAGG - Intronic
921381295 1:214527097-214527119 AAGAAAAAAAAAAAAACAGAAGG + Intronic
921493351 1:215806230-215806252 GAGAAAGAAAAGAAAAATAAAGG - Intronic
921670351 1:217917818-217917840 GAGAAAAATAATAAAAATAAAGG + Intergenic
921753927 1:218830642-218830664 GAAAAAAAGAATAAAACTGGAGG + Intergenic
921928966 1:220738024-220738046 AAGCAAAAAAATAAAACTGAAGG - Intergenic
921983047 1:221279588-221279610 AAGAAAAAAAAAAAAACAGAAGG - Intergenic
922248021 1:223819383-223819405 GTAAAGAGTAAGAAAACTGAGGG + Intronic
922375433 1:224959238-224959260 GAGAAAGATAAGAAAACAAGAGG - Intronic
922433577 1:225581135-225581157 CAGAAAAAAAAGAAAAATGTGGG + Intronic
922684136 1:227626151-227626173 GAGAAAAATATGACAAGGGAGGG + Intronic
922921205 1:229306337-229306359 AAGAAAAAGAAAAAAAATGAGGG - Intergenic
922989187 1:229891321-229891343 GACAACAATAAGAAAACATATGG - Intergenic
923039675 1:230310579-230310601 GAGAACAATAAGCAAAGTCATGG - Intergenic
923254840 1:232212641-232212663 GAAAAAAAAAAAAAAACAGATGG + Intergenic
923388143 1:233486094-233486116 AAGAGAAATAAGAAACCAGAGGG + Intergenic
923710037 1:236380391-236380413 CTGGAAAATAAGAAGACTGAAGG + Intronic
923920101 1:238554291-238554313 AATAAAAATTAGAAACCTGAGGG - Intergenic
923949150 1:238927426-238927448 GAGAAAAAGCTGAAAACAGAAGG + Intergenic
923955151 1:239008829-239008851 CAGAAAGATGAGAATACTGAGGG + Intergenic
924174120 1:241372354-241372376 ATTTAAAATAAGAAAACTGAGGG - Intergenic
924204635 1:241698982-241699004 GAGAAGAATGAGAAAACTGAGGG + Intronic
924251162 1:242134379-242134401 TAAAAAAAAAAAAAAACTGAAGG - Intronic
924270080 1:242323200-242323222 GGGAAAAAAAAGAAAACTCCAGG + Intronic
924664441 1:246056316-246056338 GAGAAAAAGAAAAAAACGGAGGG + Intronic
924681278 1:246236671-246236693 CAGAAAAATAAAAAAACTTTGGG - Intronic
924870472 1:248038350-248038372 TAGGAAAATGAGAAAAATGAGGG - Exonic
924924100 1:248661631-248661653 GAAAAAAAAAAAAAAACTGGTGG + Intergenic
1062983459 10:1744904-1744926 CAGAAAAATAAAAAAAATGCAGG + Intergenic
1063656149 10:7991040-7991062 GAGAAAAAAAAGAAAAGAGAAGG - Intronic
1063743130 10:8847507-8847529 GAGAAAAATAACCAAAAAGATGG + Intergenic
1064253732 10:13726892-13726914 CAGAAAAAAAAGCAAACTAACGG - Intronic
1064635072 10:17357123-17357145 GAAAAAAAAAAAAGAACTGAAGG - Intronic
1064679801 10:17798618-17798640 GAGAAAAATCCTAAAACAGAGGG - Exonic
1064687691 10:17881025-17881047 GAGAAAAAAAGAAAAACTGCAGG - Intronic
1064757615 10:18586169-18586191 GAGAAAAACATGAAAAATTATGG + Intronic
1064793227 10:18982845-18982867 GAGAAAACTAAGAAAAATTGTGG - Intergenic
1064977313 10:21131783-21131805 GAAAAAAATAAGAAAATGAAAGG + Intronic
1065141607 10:22723718-22723740 GAAAAAAAAAAGAAAACTCATGG - Intergenic
1065168499 10:23005249-23005271 AAAACAAACAAGAAAACTGACGG + Intronic
1065173862 10:23058224-23058246 GAGAAAATTAAGAAAACCAAAGG - Intergenic
1065185584 10:23167804-23167826 GAGAAAAATTAGAGAAGTGGAGG + Intergenic
1065362488 10:24902102-24902124 GAGGGAAAGAAGGAAACTGATGG + Intronic
1065467308 10:26038139-26038161 GCAAAAAATAACAAAACTGGTGG - Intronic
1065646587 10:27841388-27841410 AATAAAAATAAGAAAAAAGAAGG - Intronic
1065793821 10:29287423-29287445 CAGAAGAATAATAAAATTGAAGG - Intergenic
1065948767 10:30631773-30631795 CAGAAAAAGAACAAAATTGAAGG + Intergenic
1065976846 10:30849240-30849262 GAGAAAAGGAAGAAAACGGAAGG - Exonic
1065980821 10:30895057-30895079 GAGAAAAATCAGAACGCAGAAGG + Intronic
1066172171 10:32861124-32861146 AAAAAAAAAAAGAAAGCTGAAGG + Intronic
1066173378 10:32876995-32877017 GGGAAAAATAGGAAAATTTAAGG - Intronic
1066431040 10:35352059-35352081 GAATAAAATAAGTGAACTGAAGG - Intronic
1066665289 10:37776883-37776905 TTGACAAACAAGAAAACTGACGG - Intronic
1066679038 10:37918273-37918295 GATAAAAATAAGAACACTAGAGG + Intergenic
1066951405 10:42121733-42121755 GAGAAAAGGAAGAAAAGGGAGGG - Intergenic
1066986505 10:42472889-42472911 GAGAAAATTATGCAAACTGGAGG + Intergenic
1067052055 10:43027301-43027323 GGGAAAAATAAGAGCTCTGAAGG - Intergenic
1068102709 10:52575910-52575932 GAGATAAATAATAAATGTGAGGG - Intergenic
1068148412 10:53100548-53100570 AAAAAAAAAAAGAAAGCTGATGG - Intergenic
1068362117 10:55989643-55989665 CAGATAACAAAGAAAACTGAAGG + Intergenic
1068427222 10:56882470-56882492 GGGAAAAATTAGATAATTGAGGG + Intergenic
1068507724 10:57924233-57924255 GAAAAAAAAAAAAAAACTGAAGG + Intergenic
1068571823 10:58638242-58638264 GAGATGAATAAGAAAACTCCTGG - Intronic
1068606375 10:59009637-59009659 AAAAAAAAAAGGAAAACTGAGGG - Intergenic
1068615610 10:59112132-59112154 CAGAACAATGAGAAAACAGAAGG - Intergenic
1068645876 10:59466758-59466780 GACAAAAAGAAGAACACTAAAGG + Intergenic
1068677994 10:59787717-59787739 GGCTAAAATAAGAAAATTGATGG - Intergenic
1068719682 10:60230899-60230921 AAAAAAAAAAAGAAACCTGAAGG + Intronic
1068904108 10:62303465-62303487 GAGAAAAAAAAGAAAAAAAAAGG - Intergenic
1069278317 10:66620881-66620903 GAGAAAAATAACAAAGATTAGGG - Intronic
1069586468 10:69607273-69607295 GAGAAACATAAGAGAGCTGCCGG + Intergenic
1069727284 10:70588822-70588844 GAGAAAAATAATGGAAGTGAAGG + Intergenic
1069875174 10:71558358-71558380 GAGAAAAGTAAGAAAATTAGAGG - Intronic
1070061097 10:72983801-72983823 GAGAAAAAAAAAACAACTGATGG - Intergenic
1070211371 10:74326167-74326189 AACAAAAATAAGAAAACTATAGG - Intronic
1070495955 10:77022732-77022754 GTGAAAAAAAGGAAAACTTATGG - Intronic
1070515675 10:77203667-77203689 GAGAAAAATAAATGAATTGAGGG + Intronic
1070983832 10:80671314-80671336 AAAAAAAAAAAGAAAATTGAAGG - Intergenic
1071100621 10:82033092-82033114 GAAAAAAATGTGAAAATTGAAGG + Intronic
1071148125 10:82599078-82599100 GATGAGAAGAAGAAAACTGAAGG + Intronic
1071183338 10:83012525-83012547 AAGAAAAATAGGAGAACTGTGGG - Intergenic
1071361487 10:84850710-84850732 GAAAAAAAAAAAAAAACTCAAGG - Intergenic
1071366366 10:84904490-84904512 GAGAGAAAAGAGAAAAATGAAGG - Intergenic
1071774908 10:88775490-88775512 GAGATAACTAATATAACTGAGGG + Intronic
1071934362 10:90510923-90510945 GAAAAAAAGAACAAAACTGATGG + Intergenic
1071947577 10:90663751-90663773 GAACAAAAGAACAAAACTGAAGG + Intergenic
1071958889 10:90788719-90788741 TAGAAAAACAAGAAAAATAAAGG + Intronic
1072038748 10:91588248-91588270 GATAAATATAAGAAAACTAGTGG + Intergenic
1072103765 10:92254510-92254532 GAGAAACATAAAAAAACCCAAGG - Intronic
1072223121 10:93344565-93344587 GAGAAAAATAAGAAAAAGAAGGG + Intronic
1072308868 10:94134694-94134716 GAGAGAAATAAGGAAGCTGCTGG + Intronic
1072309119 10:94137413-94137435 GAAAAAATTGAGATAACTGATGG + Intronic
1072325132 10:94290313-94290335 GAGAAAAATAAGAAAGAAAATGG - Intronic
1072520967 10:96229812-96229834 GAAAAAGAAAAGAAAAATGAGGG - Intronic
1072853087 10:98917664-98917686 GAGAAAAATAATAATAATAAGGG - Intronic
1072854702 10:98935129-98935151 GAGGAACATAAGCAACCTGATGG - Intronic
1072911323 10:99504334-99504356 GAGGAAAATAAAAAAATAGAGGG + Intergenic
1073462730 10:103676044-103676066 GAAAAAAAAAAGAAAAGTTAAGG + Intronic
1073490673 10:103851146-103851168 GAGAAAAAAAAAAAAAAAGAAGG + Intronic
1073830788 10:107380573-107380595 GAAGAAAATAGGAAAACAGAAGG - Intergenic
1073866387 10:107809225-107809247 GACAATAATAATAATACTGACGG - Intergenic
1073911298 10:108348107-108348129 AAGAGATATAAGAAAAGTGAGGG - Intergenic
1074011642 10:109487889-109487911 AAGAAAAAGAAGAAAACTCTAGG - Intergenic
1074069660 10:110053641-110053663 GTGAAAATTAAGACTACTGATGG - Intronic
1074127090 10:110537130-110537152 AACAAAAAGAACAAAACTGAAGG + Intergenic
1074157511 10:110811749-110811771 GAAATAAATGAGAAAACTGGAGG + Intronic
1074281478 10:112055753-112055775 CTTAAAAATGAGAAAACTGAGGG + Intergenic
1074297150 10:112200724-112200746 GATAAAGGTAAGCAAACTGAAGG + Intronic
1074657580 10:115611948-115611970 GAAAATAAGAAGACAACTGAGGG + Intronic
1074856675 10:117479106-117479128 CAGAAAAAAAAAAAATCTGAGGG - Intergenic
1074864330 10:117536129-117536151 GAGGAAAAAAAGGAAACTGGAGG - Intergenic
1075226995 10:120638696-120638718 GAGAAAAGGAAGAAAACAGGAGG + Intergenic
1075357940 10:121799751-121799773 GAGAAATATTATAAAACTCATGG + Intronic
1075361252 10:121836825-121836847 AAGAAAAAGAAGAAAGCTGAAGG + Intronic
1075610001 10:123845613-123845635 GAGAAAAATAAGAAAAGCAGAGG + Intronic
1075856387 10:125633498-125633520 GAGAAAATGTAGAAAACAGAGGG + Intronic
1075876894 10:125815033-125815055 GAGCAAAACAATAAAACTGAAGG - Exonic
1076000341 10:126907905-126907927 AAGAAAAAATAGAAAACTGTTGG + Intronic
1076185275 10:128441674-128441696 GAGGAACATAAGAGACCTGATGG + Intergenic
1076557547 10:131337539-131337561 AGGAAAAATGAGAAAAATGAGGG - Intergenic
1077428694 11:2502737-2502759 GAGCAAAAGAACAAAACTGGAGG + Intronic
1077788144 11:5407670-5407692 AATAAAAAAAAAAAAACTGATGG - Intronic
1077833867 11:5906029-5906051 GCAAAAAATAACAAATCTGAAGG - Intronic
1077839480 11:5960104-5960126 GAGAAAGAAAACAAAAATGAAGG - Intergenic
1077912393 11:6584657-6584679 GAGCAAAAGAACAAAACTGAAGG + Intronic
1077932006 11:6743193-6743215 GAGAGAAATAAGAAAATGCATGG + Intergenic
1077941643 11:6849260-6849282 GAGAAAAACATGAGATCTGAGGG + Intergenic
1077941655 11:6849333-6849355 GAGAAAAACATGAGATCTGAGGG - Intergenic
1078024515 11:7681862-7681884 AAAAAAAAAAAGAAAAATGAAGG + Intergenic
1078297502 11:10088596-10088618 GAGAGAAAGCAAAAAACTGAAGG + Intronic
1078305933 11:10186369-10186391 AAGAAAAATAAGAAAATAGCTGG + Intronic
1079172482 11:18109542-18109564 AAGAAAAAAAACAAAACTCATGG - Intergenic
1079276961 11:19049089-19049111 GAGAAAAAGAACAAAGCTGAAGG + Intergenic
1079489448 11:20971348-20971370 GAGAAGAAGAAAAAAACAGAAGG + Intronic
1079509943 11:21199077-21199099 GAAAAAAATAGGCAAACTCAAGG + Intronic
1079551213 11:21700640-21700662 GAGAAAATTAAGAAAATAGAAGG + Intergenic
1079572238 11:21958085-21958107 AACAAAAAGAACAAAACTGAAGG + Intergenic
1079593911 11:22217579-22217601 GAGAAAAATAATAATAATAAAGG - Intronic
1079601026 11:22313658-22313680 GAGAAAAATATGATAAGGGAGGG + Intergenic
1079667841 11:23130297-23130319 AATAAAAATAATAAAGCTGAAGG - Intergenic
1079683644 11:23329093-23329115 AAGAAAAATAAGGAAACTAAGGG - Intergenic
1079707693 11:23641038-23641060 GAGCAAAAGAAAAAAACTGGAGG + Intergenic
1079723136 11:23845078-23845100 GAAAAAAAGAAGAAAAAAGAAGG - Intergenic
1079942794 11:26702730-26702752 TAAAAAAATAAGAAAACAGAGGG - Intronic
1080111338 11:28571363-28571385 TAGAAAAATAATAATAATGAAGG + Intergenic
1080197632 11:29630871-29630893 CAGAAAAGTAAGAAAGTTGAGGG + Intergenic
1080439540 11:32278737-32278759 GGGAAAAATAAGAAACACGATGG + Intergenic
1080496773 11:32828512-32828534 GAAAAAAAAAAAAAAAATGAAGG + Intergenic
1080601423 11:33824042-33824064 GAGATAAAGAACAAAACTGGAGG - Intergenic
1080951046 11:37033393-37033415 GAGAAAAATGTGAAAATTCAGGG + Intergenic
1081043362 11:38239449-38239471 AAGAAAAGAAAGAAAACTGCAGG - Intergenic
1081060740 11:38472805-38472827 GAGAAAAAAATAAAAAATGATGG - Intergenic
1081064053 11:38518036-38518058 GAGAAAAACAAGAAAAATGAAGG + Intergenic
1081206829 11:40285270-40285292 GAGAAGATTAGGAAAACAGAAGG + Intronic
1081270284 11:41075003-41075025 AAAAAAAAAAAGAAAATTGAAGG - Intronic
1081288272 11:41299884-41299906 GACCAAAATAAACAAACTGATGG + Intronic
1081777979 11:45689450-45689472 TTGACAAATGAGAAAACTGAAGG + Intergenic
1081954374 11:47076968-47076990 AAAAAAAAAAAGAAAACTGAAGG + Intronic
1082075044 11:47969747-47969769 TAGAAAAATAAAAAACCAGATGG + Intergenic
1082111173 11:48276187-48276209 GGGAAAAAGAACAAAACTGGAGG - Intergenic
1082826596 11:57584273-57584295 AAGAAAAAGAAAAAAAATGAGGG + Intergenic
1083032209 11:59603523-59603545 AAAAAAAAAAAAAAAACTGAAGG - Intronic
1083035154 11:59630119-59630141 GAGAACAATCAGATAAATGATGG + Intergenic
1083236197 11:61352301-61352323 AATAAAAATAAAAAAAATGAGGG - Intronic
1083433307 11:62626197-62626219 GGGAAAAATAACAGAACAGAAGG + Intronic
1083914595 11:65732704-65732726 GAGCAAAATAACAAATCTGGAGG + Intergenic
1084109933 11:67007449-67007471 GATAAAAATAGCAAACCTGAAGG - Exonic
1084668523 11:70591377-70591399 AAGAAAAAAAAGAAAAAAGAAGG + Intronic
1084909158 11:72373586-72373608 GGGAAAAATAAAAAAGCAGAGGG - Intronic
1085230043 11:74959309-74959331 GATTAAAATAAGATAATTGAAGG + Intronic
1085327407 11:75617629-75617651 GTGCAAAATAAGAAAACTTACGG + Intronic
1085463306 11:76708006-76708028 GAAAAAAAAAAGAAAAAAGAAGG - Intergenic
1085955895 11:81394583-81394605 TAAAAAAAAAAAAAAACTGAGGG - Intergenic
1086070415 11:82793195-82793217 GAGAGGCATAAGACAACTGAAGG - Intergenic
1086090533 11:83000462-83000484 AAGAAAAATAATAAAACTCACGG + Intronic
1086129619 11:83387307-83387329 GAAGAAAAAAAGAAAACTGCTGG + Intergenic
1086173755 11:83865481-83865503 GAGAAAAAAAAGAAAATGAATGG + Intronic
1086248998 11:84791382-84791404 GAGCAAAAGAACAAAACTGGAGG - Intronic
1086261058 11:84941165-84941187 GAGAAAAAGAACAAAACTGGAGG - Intronic
1086274115 11:85104745-85104767 TTGAAAAACAAAAAAACTGATGG + Intronic
1086588285 11:88481617-88481639 AAGAAAAATAGGAAAACGGGTGG - Intergenic
1086609205 11:88733867-88733889 GAGAAAAATAGGGAAAAAGAGGG + Intronic
1086652212 11:89306109-89306131 TAAAAAAAAAAGAAAACTTAGGG - Intergenic
1087051838 11:93893669-93893691 AAGAAAAAGAAGAAAAATGTAGG - Intergenic
1087201709 11:95352076-95352098 GGCAAAAAGAACAAAACTGATGG + Intergenic
1087403304 11:97695777-97695799 AACAAAAATAAGAAAAAAGAGGG - Intergenic
1087562580 11:99809331-99809353 GAGAAAAAAAATAAACCTCAAGG - Intronic
1087580775 11:100049447-100049469 AAAAAAGATATGAAAACTGATGG + Intronic
1087755080 11:102047001-102047023 GAAAAAAAAAAAAAAACAGATGG + Intergenic
1087808800 11:102586898-102586920 GAGAAAACCAACAAAACTGAAGG - Intronic
1087884329 11:103459969-103459991 GAAAAAAAAAAAAAAGCTGAAGG + Intronic
1088236040 11:107724246-107724268 GAAAAAGAAAAGAAAAGTGAGGG - Intergenic
1088422206 11:109660707-109660729 GGGAAAAGAAAGAGAACTGAAGG + Intergenic
1088491244 11:110389945-110389967 AAGAAATTTAAGAAAAGTGAAGG - Intergenic
1088738054 11:112744882-112744904 GAGAGAAAGAAGAAAACACAGGG - Intergenic
1089483681 11:118828259-118828281 GTAAAAAAGAAGAAAACAGAAGG + Intergenic
1089501007 11:118931071-118931093 GAGAAAAGTAAGGCAATTGAAGG - Intronic
1089597742 11:119592398-119592420 AAAAAAAAGAAGAAAACTAAAGG - Intergenic
1089738642 11:120566700-120566722 AAAAAAAAAAAAAAAACTGAGGG - Intronic
1089959230 11:122600968-122600990 GAGAGAAAAAAGAAAAAAGAAGG + Intergenic
1089978846 11:122755793-122755815 AAGATAAAAAAGAAAACTTATGG + Intronic
1090593997 11:128300883-128300905 AAAAAAAATAAGAAAAATGTAGG - Intergenic
1090647750 11:128779260-128779282 GAGCAAATAAAGAAAAATGATGG - Intronic
1090653534 11:128825794-128825816 GAGAGAAATAATAAAACGGAGGG - Intergenic
1090713531 11:129409923-129409945 GAGAAAGATAAGAAAATTAGTGG - Intronic
1090967160 11:131609046-131609068 GTTAAAAATAACAAAACTGGGGG + Intronic
1091106104 11:132921179-132921201 AAGAAAAACAAAAAAGCTGAGGG - Intronic
1091444548 12:536016-536038 CAGAAAATTCAGAAAAGTGAAGG + Intronic
1091491611 12:937420-937442 CAGAAAAAAAAAAAAGCTGAAGG - Intronic
1091640356 12:2231516-2231538 TAAGAAAATGAGAAAACTGAAGG + Intronic
1091897699 12:4118389-4118411 GAGAAAAAAAAGAAAAGAGTAGG - Intergenic
1092701023 12:11231099-11231121 GAAAAAAAAAAAAAAACAGAGGG + Intergenic
1092829330 12:12428571-12428593 AAGAAGAAGTAGAAAACTGAAGG + Intronic
1092952508 12:13520323-13520345 GACAAAAAAAAGAAAACTTCAGG - Intergenic
1092974192 12:13728308-13728330 GAGAAGAAAAAGAATATTGAAGG + Intronic
1093059448 12:14588086-14588108 GAGAAAAATAAGAAGAAGAAGGG - Intergenic
1093287198 12:17279392-17279414 GAAAAAAATAACAAATCTGTGGG - Intergenic
1093288171 12:17291831-17291853 GAAAGAAAAAAGAAAACTGAAGG - Intergenic
1093311809 12:17597568-17597590 AAGAAAAAAGAGCAAACTGAAGG + Intergenic
1093313452 12:17619633-17619655 GAGAAAAAGAAAAAAACTTGTGG - Intergenic
1093315650 12:17646851-17646873 GGAAAAAATGAGGAAACTGACGG + Intergenic
1093439762 12:19180425-19180447 CAGAAAAATAATAAAAATGTAGG + Intronic
1093445516 12:19252710-19252732 TAGAAAAAAATGAAATCTGAAGG - Intronic
1093563918 12:20578985-20579007 GAGAAAAAAAATAAAACTGATGG - Intronic
1093644763 12:21572011-21572033 GGGCAAAACAAGAAAACTAAAGG + Intronic
1093724823 12:22492207-22492229 TAGAAAAATAAGATAACAGAAGG + Intronic
1093828094 12:23719796-23719818 AAAAAAAAAAAAAAAACTGATGG + Intronic
1093841570 12:23908860-23908882 TAGAAAAATAGGAAAGCTTATGG - Intronic
1094273646 12:28644976-28644998 GAGAAACATAAATAACCTGATGG - Intergenic
1094283809 12:28769833-28769855 GAGATAAATAAGAAAAACAAAGG - Intergenic
1094332477 12:29310063-29310085 TAGAAAAATCAGAAATCGGAAGG - Intronic
1094522986 12:31212534-31212556 GAGAAAGACAATAAAATTGATGG + Intergenic
1094610045 12:31986717-31986739 GAGAAAGATTGGAAAACTAAAGG + Intronic
1095154043 12:38831187-38831209 GAGAATAATGAGAAAAGAGAAGG + Intronic
1095256236 12:40040065-40040087 GAAAAAAATCAGATAACTGAAGG + Intronic
1095360110 12:41327189-41327211 GAGAGAAATAAAAAAAATAATGG - Intronic
1095608897 12:44103774-44103796 GAAAAGAAAAAGAAAAATGATGG - Intronic
1095701852 12:45198734-45198756 GAAAAAAATAAGGGAACAGAAGG + Intergenic
1095915948 12:47478735-47478757 CAACAAAATAAGAAAACTGCAGG + Intergenic
1096190951 12:49618754-49618776 GAGAAAAATAAGAAATTAGAAGG + Intronic
1096348960 12:50878200-50878222 GAAAAAAAAAAAAAAACTGAAGG + Intronic
1096350588 12:50896677-50896699 GAAAAAAATAATAAAACAGAAGG + Intergenic
1096350690 12:50897641-50897663 TAGAAAAAAAAGAAAACTACAGG + Intergenic
1096351524 12:50904915-50904937 GAGAAAAATATGATAAGGGAGGG + Intergenic
1096768680 12:53917333-53917355 GAGAAAACAAGGAAAACTGGGGG - Intergenic
1096787795 12:54027604-54027626 GAGAAAAAGAAGTAAAATGTAGG - Intronic
1097002692 12:55891162-55891184 GAAAAAAATAAGAAATATAAGGG + Intergenic
1097085452 12:56464788-56464810 AAGAAAAAAAAAAAAACTGGTGG + Intronic
1097311817 12:58127347-58127369 GAGAACAATAATCAAATTGAGGG + Intergenic
1097615022 12:61873607-61873629 TATAAAAATAAGGAAACTAAAGG - Intronic
1097730855 12:63126556-63126578 GATATAAACAAGAATACTGAGGG - Intergenic
1098190618 12:67944732-67944754 GAGAAAAATAGGGAGAATGATGG - Intergenic
1098276612 12:68818377-68818399 CAGAAAACTAAGAAAAGTAAAGG + Intronic
1098410102 12:70172575-70172597 GAGAAGAATAAGAAAAGTACAGG + Intergenic
1098582556 12:72117515-72117537 AACAAAAATAACAAAACTGGAGG - Intronic
1098739559 12:74155209-74155231 CAGAATAATTAGAAAACTGAGGG - Intergenic
1098765238 12:74479721-74479743 AAAAAAAAAAAGAAAACTAAAGG + Intergenic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1098877791 12:75884593-75884615 GAGAAAGATAAGAATAAAGAGGG - Intergenic
1098937828 12:76500713-76500735 AAGAAAAAAAAGAAAAAAGAAGG - Intronic
1099099319 12:78418282-78418304 GAGAATAACCAGCAAACTGACGG - Intergenic
1099201223 12:79679510-79679532 GAGAAAAAACAGTAAGCTGAAGG + Intronic
1099387908 12:82040115-82040137 TAGCAAAATAAAAAAACTAAAGG - Intergenic
1099464136 12:82961783-82961805 GAGACAAATAAGAAAACAAATGG - Intronic
1099784117 12:87238273-87238295 CAGCAAAATAAGAAAACTCTAGG + Intergenic
1099945104 12:89234983-89235005 GAGAAAAATAAAGCAAATGAGGG - Intergenic
1099945811 12:89242845-89242867 CAAAAAAATAAGAAAACTATAGG - Intergenic
1099988804 12:89700671-89700693 GAAAATAAAAAGAAATCTGAAGG - Intronic
1100060632 12:90570758-90570780 AAGCAAAATAACAAAACTGGAGG - Intergenic
1100064740 12:90628469-90628491 GAGAAAATTAATGATACTGAAGG - Intergenic
1100415886 12:94374184-94374206 GAAAAAAAGAAGAAAAATCAGGG + Intronic
1100518545 12:95351612-95351634 GAGAAAAAGAAGCAATCTAAAGG + Intergenic
1100577222 12:95904393-95904415 CAGAAAATTATCAAAACTGACGG - Intronic
1100702974 12:97167447-97167469 GACAAAAAGAAGGACACTGAGGG + Intergenic
1100808097 12:98309099-98309121 GACAAAAAAAAAAAAACTGAAGG + Intergenic
1101057556 12:100934528-100934550 GCAAAAAAAAACAAAACTGAAGG - Intronic
1101639047 12:106572413-106572435 GATAAAAACAAGGACACTGAAGG + Intronic
1101927058 12:108980924-108980946 GAAAAAAATAAAAATACTAAAGG + Intronic
1101980508 12:109402287-109402309 GAGAAAAATAAAAAAAATGTTGG - Intronic
1101980549 12:109402617-109402639 AATAGAAATAAGAAAAATGAAGG + Intronic
1102113598 12:110383899-110383921 GAAAAAAAAAAGAAAAAAGAAGG + Intronic
1102181433 12:110915514-110915536 GAGAAAAAAAAGATATCTGAAGG + Intronic
1102317780 12:111903909-111903931 AAAAAAAAAAAAAAAACTGAAGG + Intergenic
1102457633 12:113080542-113080564 AAGAAAAAAAAGAAATCAGAAGG + Intronic
1102474924 12:113182550-113182572 AAAAAAAAGAAGAAGACTGAAGG - Intronic
1102640044 12:114359096-114359118 AAGAATAATAAGAAAACGGCCGG + Intronic
1102692822 12:114774647-114774669 TAAAAAAATAATAAAACAGATGG - Intergenic
1102764274 12:115418277-115418299 GAGAAAGACCAGAAAACTGCTGG - Intergenic
1102886374 12:116525202-116525224 GAGAAAAAGAACAAAAGAGAAGG - Intergenic
1103115521 12:118326433-118326455 AACAAAAAGAAGAAAACTGGAGG - Intronic
1103169855 12:118807920-118807942 AACAAAAATAACAAAACTGAAGG - Intergenic
1103170410 12:118813921-118813943 GAGAAAAAGAAAAGGACTGAAGG - Intergenic
1103579663 12:121905200-121905222 AAGAAAAAGAAGAAAACTCATGG - Intronic
1103803732 12:123556519-123556541 GAGAAAAATATGAGAAGGGAGGG - Intergenic
1103814416 12:123642152-123642174 AAGAAAAAGAAAATAACTGAAGG - Intronic
1103821839 12:123705155-123705177 AAAAAAAAAAAAAAAACTGATGG - Intronic
1104204586 12:126626166-126626188 GGGAAAATTCTGAAAACTGAAGG - Intergenic
1104474800 12:129062361-129062383 GATAAAATTAAAAAAAATGAAGG + Intergenic
1104626662 12:130362009-130362031 TAGTAATATATGAAAACTGAAGG + Intronic
1105272271 13:18888658-18888680 AAAAAAAAAAAAAAAACTGATGG - Intergenic
1105343244 13:19547870-19547892 GAAAAAAAGAAGAGAAATGAGGG + Intergenic
1105513125 13:21067662-21067684 AATAAAAATAATAAAACTCATGG - Intergenic
1105583665 13:21724098-21724120 GAGAAGAGTAATAAAAATGATGG - Intergenic
1105654085 13:22415724-22415746 GAGAAAACCAACAAAACTAATGG + Intergenic
1105670825 13:22613240-22613262 GAGAAAAAGAACAAAGCTGAAGG - Intergenic
1105682175 13:22739925-22739947 GAGAAAGATAAGAAAAAGGAGGG + Intergenic
1106064203 13:26328826-26328848 AAGAAAAATAGGAAAATTGGAGG - Intronic
1106951231 13:34886055-34886077 GAGAAAGGAAAGAAAAGTGAGGG + Intergenic
1107287371 13:38809769-38809791 GAGCAAAAGAACAAAACTGAAGG - Intronic
1107403394 13:40090952-40090974 GGGATAAATAAGAAGACAGAAGG + Intergenic
1107476538 13:40742059-40742081 GAAAAAAAGAAGAGAACTGAGGG + Intronic
1107510636 13:41080646-41080668 GAAAAAAATAAAAATAGTGATGG + Exonic
1107604746 13:42046985-42047007 GAGAAAAATAATCAAAATAATGG - Intronic
1107671680 13:42752778-42752800 GTCACAAATAAGAAAGCTGAGGG + Intergenic
1107691583 13:42958644-42958666 GAGAAAAATAAAGATACTTAAGG + Intronic
1107932633 13:45318969-45318991 GAAAAGAAAAAGAAAACTGGAGG + Intergenic
1108086428 13:46797665-46797687 GGGAGAAAACAGAAAACTGATGG - Intergenic
1108288367 13:48931972-48931994 CAGAATAATAAGAAAATTGAAGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108482692 13:50890728-50890750 TAGAAAAGTCAGAAAACTAAGGG - Intergenic
1108626964 13:52239244-52239266 AAAAAAAAAAAGAAAACTAAAGG + Intergenic
1108659102 13:52567217-52567239 AAAAAAAAAAAGAAAACTAAAGG - Intergenic
1108685168 13:52813225-52813247 GAGAAAAATAAGCTGACAGAGGG - Intergenic
1108924764 13:55727735-55727757 AATAAAAATAAGAATACTTACGG + Intergenic
1109135112 13:58639458-58639480 GAGAAAAATCTGAAAATAGAAGG - Intergenic
1109340888 13:61056977-61056999 TTCAAAAATAAGAAAACTCAAGG - Intergenic
1109368838 13:61395109-61395131 GAGAAAAATGAGACAACTCTAGG + Intergenic
1109433524 13:62268312-62268334 GAAAGAAATGAGAAAACTGAAGG + Intergenic
1109467627 13:62758320-62758342 AAGAAAAGTAAAAAAACTTATGG + Intergenic
1109522103 13:63526835-63526857 GAGAAAAATAATAAATAAGAAGG + Intergenic
1109555172 13:63964668-63964690 GAGAAAAAGAAAAAAACAAAGGG + Intergenic
1109571900 13:64203798-64203820 GGGAAGAATAAGGAAAATGAAGG + Intergenic
1109748055 13:66652679-66652701 AGCAAAAATAAGAAAACTGGAGG + Intronic
1109758722 13:66797998-66798020 AAGAAAAATAAGAAAAAATAGGG + Intronic
1109870029 13:68321988-68322010 AAAAAAAAAAAAAAAACTGAAGG - Intergenic
1109939996 13:69349217-69349239 TAAAAAAATAGGAAAATTGATGG + Intergenic
1109979999 13:69895243-69895265 GGGAAAAATAAGAAAACAAAGGG - Intronic
1110034029 13:70655747-70655769 CAAAAAAATACGAAAACAGAGGG - Intergenic
1110045620 13:70826420-70826442 GAGAGAAATAAGAAAAATGTTGG - Intergenic
1110096177 13:71524634-71524656 GACAGAAATAAAAAAAATGAAGG + Intronic
1110129453 13:71989250-71989272 GAGAAAAATCAGTAAACTCATGG + Intergenic
1110183441 13:72644769-72644791 GAGAAAAGGAAGAATACTGTTGG - Intergenic
1110292785 13:73826272-73826294 GAGATAAATAAAAATGCTGAAGG - Intronic
1110396164 13:75031884-75031906 GAAAAAAATAAGGAAAATGATGG - Intergenic
1110429534 13:75407870-75407892 GAAAAAAAAAAGAAAAGAGATGG + Intronic
1110478210 13:75942915-75942937 GAGAACCATGTGAAAACTGAAGG + Intergenic
1110562667 13:76926112-76926134 GAAGAAAATAAGAGAACTGCAGG + Intergenic
1110588514 13:77224371-77224393 GAGAAAAGAAAGAAAAAAGAAGG + Intronic
1110724423 13:78803252-78803274 GAGTAAAAGAACAAAACTGGAGG - Intergenic
1110725707 13:78820702-78820724 GACAAAGATAAGCAAACTGCAGG - Intergenic
1110809856 13:79800294-79800316 GGAAATATTAAGAAAACTGAGGG + Intergenic
1110928566 13:81186656-81186678 GAAGAAAATAAAAAAACTCATGG + Intergenic
1111099769 13:83568540-83568562 GATTAATATAAGAAAACTGAAGG + Intergenic
1111225770 13:85268565-85268587 GAAAAAAAAAAAAAAACTCAAGG + Intergenic
1111304206 13:86384800-86384822 GACAAAAATCTGAAAACTAATGG + Intergenic
1111314782 13:86540515-86540537 GAAGAAAATAAGAAAAGGGAAGG + Intergenic
1111480895 13:88824930-88824952 GAGAAAAAGAAGGAAAAGGAAGG - Intergenic
1111493407 13:89015854-89015876 GAGAAAAATAAGAATAAAAATGG + Intergenic
1111494075 13:89024860-89024882 AAGAAAACTAAAAAAACTGTAGG - Intergenic
1112077841 13:95932001-95932023 AAGAAAAAGAACAAATCTGAAGG - Intronic
1112086518 13:96037827-96037849 GAGAAACATAAACAAATTGAAGG + Intronic
1112103286 13:96213669-96213691 GAGAAAACTAGGAAAACTCCTGG + Intronic
1112224402 13:97523782-97523804 GAGAGGAATAAAAACACTGATGG + Intergenic
1112372504 13:98806548-98806570 AAGAAAAATGAAAAAACAGATGG + Intronic
1112421845 13:99259340-99259362 GAGAAAAAAAAAAAAAAGGATGG - Intronic
1112434941 13:99385196-99385218 GAGAAAACGCAGAAACCTGAGGG - Intronic
1112537454 13:100274163-100274185 AAGAATGATATGAAAACTGAAGG - Intronic
1112627383 13:101121085-101121107 AAGGTAGATAAGAAAACTGAGGG + Intronic
1112694874 13:101936668-101936690 AAGAAAAATAAGAGAACTTTAGG - Intronic
1112884082 13:104147473-104147495 GAGAAAAATAGGATAAAAGAAGG + Intergenic
1112936987 13:104813065-104813087 AGGAAAAATAAGAAAATTAATGG + Intergenic
1113132411 13:107052719-107052741 GGTAGAAATGAGAAAACTGAAGG + Intergenic
1113283819 13:108823087-108823109 AAGAAAAATCAGAAAAATGATGG - Intronic
1113529413 13:111010411-111010433 GAGAAATAGAAGAAAGCTTATGG + Intergenic
1114264209 14:21062442-21062464 CAGAAAAATAACCCAACTGAAGG - Intronic
1114404940 14:22447860-22447882 GAGAAAAATAAGAAATGTTATGG - Intergenic
1114691048 14:24582001-24582023 GAGAAAAAAATTATAACTGACGG - Intergenic
1114750048 14:25193814-25193836 CAGAAACACAAGAAAACTGTGGG + Intergenic
1114820474 14:26012092-26012114 GAGAAAAATAAGAAGATGGATGG + Intergenic
1115207734 14:30929243-30929265 GGGACTAATAAGTAAACTGAAGG - Exonic
1115264513 14:31487426-31487448 AAAAAAAAAAAAAAAACTGAGGG - Intronic
1115273791 14:31584140-31584162 AAAAAAAAAAAGAAAACTGCTGG - Intronic
1115570158 14:34658916-34658938 GAGACAAAGAAGAAATCAGAGGG - Intergenic
1115623258 14:35162756-35162778 GAGAAAAACAACAAAAGTGAAGG - Intronic
1115854936 14:37621227-37621249 CTGAAAAAAAAGAAAAATGAAGG - Intronic
1116147238 14:41089802-41089824 AAGAAAAAGAACAAATCTGAAGG - Intergenic
1116225071 14:42140110-42140132 GAGAAAAGTATGGAATCTGAGGG - Intergenic
1116319935 14:43448619-43448641 AAGAAAAAAAAAAAAGCTGAAGG + Intergenic
1116355329 14:43921162-43921184 AATAAAAATAAGAAAACTGGAGG + Intergenic
1116446905 14:45021473-45021495 GAGAAAAATATGATAAGGGAGGG + Intronic
1116489591 14:45490370-45490392 GAGCAAAAGAATAAAACTGGGGG - Intergenic
1116530357 14:45965293-45965315 GTGACAAATTAGGAAACTGAGGG - Intergenic
1116557274 14:46326696-46326718 GAGAAAAATAACCAAAATAAGGG + Intergenic
1116595668 14:46841305-46841327 GAGAAAAATAATAATAATAAAGG + Exonic
1116598287 14:46882745-46882767 GAGAAAAATAAAAAATCACAAGG + Intronic
1116701006 14:48241966-48241988 GAGATCAATAATGAAACTGATGG + Intergenic
1116920945 14:50573783-50573805 GAGCAAAATAACAGAACAGAAGG - Intronic
1117091359 14:52254065-52254087 CATAAAAATAATAAAACTAATGG + Intergenic
1117096115 14:52299854-52299876 GAGCAATATAAAAAAACTCAGGG - Intergenic
1117100389 14:52340054-52340076 AAGAAAAATAAACAGACTGAGGG - Intergenic
1117108820 14:52427369-52427391 GAAAAAAATAAGACAAAGGAGGG - Intergenic
1117584312 14:57184601-57184623 GAGAAAAAAGAAATAACTGAAGG - Intergenic
1117641186 14:57800662-57800684 GAGCAACATAACCAAACTGATGG + Intronic
1117684272 14:58237506-58237528 GAGAAAAAAAGGAAAACTACAGG + Intronic
1117778353 14:59205826-59205848 GAGATAAATAAGAATACAGTAGG + Intronic
1117817743 14:59615033-59615055 GAGTAACAGAACAAAACTGAAGG + Intronic
1117904494 14:60569948-60569970 GAAAAAAAAAAGAAAAAAGAAGG + Intergenic
1118083512 14:62388667-62388689 GACAAAAATAAACAAACAGAAGG - Intergenic
1118558370 14:67051255-67051277 GAGGAAAATAAATAACCTGATGG + Intronic
1118562671 14:67103298-67103320 AATAAAAAGAAGAAAACTGGAGG - Intronic
1118571293 14:67198129-67198151 CATAAACATAAAAAAACTGAGGG - Exonic
1118684108 14:68273680-68273702 AAGAAAAAAAAGAAAAATGATGG - Intronic
1118830823 14:69430604-69430626 AAGAAAAATAAGAACAAAGAAGG - Intronic
1119005221 14:70919855-70919877 AAGAAAGAAAAGAAAACTTAGGG + Intronic
1119598736 14:75959775-75959797 AAGAAAAAAAAAAAAACTGTTGG + Intronic
1119627242 14:76189142-76189164 AACAAAAAGAACAAAACTGAAGG - Intronic
1119699221 14:76741504-76741526 GAAAAAAAAAAAAAAACTTATGG - Intergenic
1119701519 14:76758919-76758941 AAGAAAAAAAAGAAAAATAACGG + Intergenic
1119935086 14:78585110-78585132 GAGAAAAATAAGAAGAAATAGGG + Intronic
1119985788 14:79135955-79135977 GAGAAAAAGAAGAAAAGTGTTGG - Intronic
1120230017 14:81831728-81831750 GAGAACATTAAGAGAACTGTGGG + Intergenic
1120236069 14:81892475-81892497 TACAAAAATAAGACACCTGAGGG - Intergenic
1120360663 14:83497700-83497722 GAGGAAAAAAAGAATACTTAAGG - Intergenic
1120415106 14:84209292-84209314 GAATAAAATAAGAAAACCTAAGG + Intergenic
1120426663 14:84356852-84356874 AGGAAAAATAACAAAACTGGAGG + Intergenic
1120436244 14:84486752-84486774 CAGAAAAATAAGAATACAAAAGG - Intergenic
1120558517 14:85960217-85960239 GAGAAAAACAAGAAGAGTTAGGG - Intergenic
1120736509 14:88058905-88058927 AGCAAAAATAACAAAACTGAAGG + Intergenic
1120790494 14:88576778-88576800 AAAACAAATAAAAAAACTGATGG - Intronic
1120918164 14:89728762-89728784 GAGAAAAAGAATGATACTGAAGG + Intergenic
1121070568 14:91016869-91016891 AAAAAAAAAAAAAAAACTGAAGG + Intronic
1121262714 14:92578248-92578270 AAGAAAAAAAAGAAAAAAGAAGG + Intronic
1121571821 14:94951991-94952013 GAGGAAAAGATGAAAACTCATGG + Intergenic
1121707085 14:96005165-96005187 GAAAAAAATAATAAAATAGATGG + Intergenic
1121889775 14:97578716-97578738 AAGAAAAACAAGAACATTGATGG - Intergenic
1122168332 14:99848967-99848989 AAAAAAAATAATAAAACTTAAGG + Intronic
1122419348 14:101565253-101565275 GAGAGAAATAAAAAAAGTGGGGG - Intergenic
1122580215 14:102767023-102767045 AAGAAAAAGAAAAAGACTGAGGG - Intergenic
1122679093 14:103443024-103443046 GAGAAAACACAGAAAAATGAGGG + Intronic
1202885003 14_KI270722v1_random:97442-97464 GAGAAATATATGGAAAGTGATGG - Intergenic
1123457618 15:20440275-20440297 GAGAAAAGCAGGTAAACTGAAGG + Intergenic
1123660453 15:22560147-22560169 GAGAAAAGCAGGTAAACTGAAGG - Intergenic
1123817426 15:23994217-23994239 GGGAAAAGAAAGAAAACAGAGGG + Intergenic
1124069796 15:26380702-26380724 GGGAAACATAAGAAAGGTGAAGG - Intergenic
1124111953 15:26798722-26798744 GACAAAAACAAGAACACTGGAGG - Intronic
1124160464 15:27263943-27263965 AAGAAAAAAAAGAAAAGTGCTGG + Intronic
1124232226 15:27955525-27955547 GAGGAAAATAAAGAGACTGACGG - Intronic
1124263767 15:28215422-28215444 GAGAAAAGCAGGTAAACTGAAGG + Intronic
1124314307 15:28654632-28654654 GAGAAAAGCAGGTAAACTGAAGG - Intergenic
1124451174 15:29792529-29792551 GGCAAAAAGAACAAAACTGAAGG - Intronic
1124589805 15:31042990-31043012 GAATAAAAGAAGATAACTGATGG - Intronic
1124789061 15:32709518-32709540 GAGAAAGAAAACAAAGCTGATGG - Intergenic
1125048244 15:35268210-35268232 AATAAATAAAAGAAAACTGAAGG + Intronic
1125050926 15:35297326-35297348 TAAAAAAAAAAAAAAACTGAGGG - Intronic
1125286136 15:38094409-38094431 GAAAAAAATGAAAAAAATGAAGG - Intergenic
1125382383 15:39100631-39100653 GAGGAAATTAAGAAGAATGAGGG + Intergenic
1125387421 15:39153037-39153059 GAGAAAAATAAGGAAAGGGAAGG + Intergenic
1125487149 15:40119554-40119576 AAGAAAAATGAAAAAACTGTTGG + Intergenic
1125874596 15:43133236-43133258 GAGAAAGAAAAGAAAACCTATGG + Intronic
1126294233 15:47119396-47119418 GAGAAAAAAGAGAAAAATGATGG + Intergenic
1126491697 15:49244023-49244045 GAGAAAAACAGGAAAATTTATGG + Intronic
1126595240 15:50378238-50378260 GGGAAAATGGAGAAAACTGAAGG + Intergenic
1127050134 15:55074098-55074120 TAGAAAAATAATAAAGCTGAAGG + Intergenic
1127272044 15:57410251-57410273 ATGTAAAATGAGAAAACTGAAGG - Intronic
1127352288 15:58165370-58165392 TAAAAAAATTAGAAAACAGATGG + Intronic
1127458669 15:59178306-59178328 GAGAAAAAGAAGCCAGCTGAGGG + Intronic
1127629194 15:60810713-60810735 GAGGAAAAAAAAAAAACTGGAGG - Intronic
1127659197 15:61084069-61084091 GAGAGACATAAGAATATTGAAGG + Intronic
1127672612 15:61210350-61210372 AAGAAAAATTCCAAAACTGAAGG + Intronic
1127685778 15:61342192-61342214 GAGAAAAATAAAAGACCTGCTGG - Intergenic
1127739415 15:61886250-61886272 CAGAAAAATTAGAAAATTTAAGG - Intronic
1127771082 15:62231218-62231240 AAGAAAAAAAAGAAAGCTGACGG + Intergenic
1127860147 15:62987266-62987288 GAGGAATATAAGAAACCTGTGGG - Intergenic
1128043476 15:64595911-64595933 GAGAAAAATAAGAGCTATGATGG - Intronic
1128278107 15:66371478-66371500 AAGAAAAATAAATAAACTCATGG - Intronic
1128694797 15:69753167-69753189 AAGAAAGATAAGAAAATTGGAGG + Intergenic
1129004424 15:72360222-72360244 GAGAAAAATCACAAAACAGCAGG + Intronic
1129013250 15:72442198-72442220 AAGAAAAAAGAGAAAAATGAAGG + Intergenic
1129036505 15:72653074-72653096 GAGTTAAATAAGAAAACAAACGG - Intergenic
1129213382 15:74084151-74084173 GAGTTAAATAAGAAAACAAACGG + Intergenic
1129397018 15:75256935-75256957 GAGTTAAATAAGAAAACAAACGG - Intergenic
1129400630 15:75281212-75281234 GAGTTAAATAAGAAAACAAACGG - Intronic
1129422912 15:75443749-75443771 AAAAGCAATAAGAAAACTGAAGG + Intronic
1129474241 15:75773949-75773971 GAGTTAAATAAGAAAACAAATGG - Intergenic
1129543818 15:76374094-76374116 CAGAAAAATTAGAAAGCTGGGGG + Intronic
1129715083 15:77842945-77842967 AAAAAAAAAAAAAAAACTGAAGG + Intergenic
1129730511 15:77928459-77928481 GAGTTAAATAAGAAAACAAATGG + Intergenic
1129837380 15:78719449-78719471 GAGTTAAATAAGAAAACAGATGG - Intronic
1129948701 15:79564718-79564740 TTAAAAAATAAGAAGACTGAGGG + Intergenic
1130073363 15:80667705-80667727 GAAAAAAATATGAAAAATCAGGG - Intergenic
1130165328 15:81450841-81450863 GAGAAAAAGAACAAAGCTGAAGG + Intergenic
1130344973 15:83034739-83034761 AAAATAAAGAAGAAAACTGATGG + Intronic
1130419215 15:83725831-83725853 ACCAAAAATAAGAAAACTGGAGG - Intronic
1130936438 15:88474773-88474795 GAATAACATAAGAAATCTGATGG - Intronic
1130962411 15:88670691-88670713 GAGAAAAAGATCAAAACTAATGG + Intergenic
1131145484 15:90008870-90008892 GGGAGAACTAAGAAAACTGTTGG + Intronic
1131355638 15:91743350-91743372 GAGAAAACAGAGAAAACTCAAGG - Intergenic
1131531625 15:93198356-93198378 GAGAAAAACAAAAGAACTAATGG - Intergenic
1131652589 15:94417289-94417311 GATAAAAATAAAAAATTTGATGG - Intronic
1131676921 15:94679796-94679818 GAGAAGAATAAGAAAAGAGAAGG - Intergenic
1131706864 15:95006164-95006186 AAAAAAAAAAAGAAATCTGAAGG - Intergenic
1131914507 15:97250177-97250199 GAGTAACGGAAGAAAACTGAAGG - Intergenic
1132003260 15:98201488-98201510 AAAAAAAAAAAGAAAAATGATGG - Intergenic
1132905731 16:2281757-2281779 GAGAAAAATCATAAATCTGCTGG + Intronic
1133081779 16:3327231-3327253 GCAAAAAATAAAAAAACTGGAGG - Intergenic
1133143179 16:3763318-3763340 GAAAAAAATAAGAAAATAGCTGG - Intronic
1133587029 16:7205533-7205555 AAGAAAAAAAAGAAAACTTACGG + Intronic
1133767365 16:8847378-8847400 AAAAAAAAAAAAAAAACTGATGG + Intronic
1133953125 16:10415180-10415202 AACAAAAGGAAGAAAACTGAAGG + Intronic
1134019934 16:10914613-10914635 GAGAAAAATAAGGACAACGAAGG - Intronic
1134172850 16:11982417-11982439 AAAAAAAAAAAAAAAACTGATGG - Intronic
1134797591 16:17056076-17056098 GACAAAAAGAATGAAACTGAGGG - Intergenic
1135374975 16:21938184-21938206 GAGGAAAATGAGAAAAATGAAGG + Intergenic
1135527455 16:23224939-23224961 GAGAAAAAGAAGAAAAGCAAAGG + Intergenic
1135833490 16:25800157-25800179 AAGAAAAATAATAAAACCAATGG - Intronic
1135953198 16:26934519-26934541 AAGAAAAGTTAGAAAATTGATGG - Intergenic
1136368951 16:29823842-29823864 GAAAAAAAAAAAAAAAATGAGGG + Intronic
1136632657 16:31498043-31498065 GGGAAAAATAACAGAACTGAAGG + Intronic
1136688638 16:32011381-32011403 GCAAAAACTAATAAAACTGAAGG + Intergenic
1137050067 16:35702624-35702646 AAAAAAAATAAAAAATCTGAAGG - Intergenic
1137738855 16:50745256-50745278 GGGAACAGTAAGACAACTGAAGG - Intronic
1138717485 16:59040580-59040602 AAGAGAAAACAGAAAACTGAGGG + Intergenic
1138878705 16:60984161-60984183 GAGAACAAAATGAAAACTGCAGG + Intergenic
1139059692 16:63233999-63234021 AGCAAAAAGAAGAAAACTGAAGG - Intergenic
1139156460 16:64448803-64448825 TAGAAAAATAAGAGAAAGGAAGG + Intergenic
1139445844 16:66998156-66998178 GAAAAAAAAACAAAAACTGAGGG + Intronic
1139773781 16:69300240-69300262 GAAAAAAAAAAGAAAAATGACGG - Intronic
1139875777 16:70144952-70144974 AAAAAAAAAAAGAAAATTGAGGG + Intronic
1140336007 16:74105778-74105800 GTGGAAAATGAGAAAAATGAAGG + Intergenic
1140677829 16:77350933-77350955 GAAAAAAAAAAGTAAAGTGAGGG + Intronic
1140702955 16:77599323-77599345 GAGACAGATGAGAAAACTGTAGG + Intergenic
1140776577 16:78254473-78254495 GAAAAGAAAAAGAAAAGTGATGG - Intronic
1140825098 16:78698865-78698887 CAGAACATTAAGAAAACTTAAGG - Intronic
1140838247 16:78815325-78815347 GAGAAAAAAAAAAAAAAAGAAGG + Intronic
1141029912 16:80578626-80578648 AAGAAATATAAGGAAACTGAGGG - Intergenic
1141425167 16:83940172-83940194 AAAAAAAAAAACAAAACTGAGGG + Intronic
1141710654 16:85697082-85697104 GAGAAAAGTGTGAAAACAGATGG - Intronic
1141728626 16:85807600-85807622 AAAAAAAAAAAGAAAACTGCAGG - Intergenic
1203091433 16_KI270728v1_random:1216400-1216422 GCAAAAACTAATAAAACTGAAGG + Intergenic
1142514946 17:421531-421553 GACAAAAATAATGAAGCTGAAGG - Intronic
1142789961 17:2256209-2256231 AAAAAAAAAAAGAAAACTTAGGG + Intronic
1142993641 17:3748284-3748306 GAGAAAAATTAAAATACTGTTGG + Intronic
1143173189 17:4941926-4941948 AAAAACAAAAAGAAAACTGAAGG + Intronic
1143259975 17:5591495-5591517 GAGAAAAAAAAAAAAAAAGAAGG - Intronic
1143346191 17:6250856-6250878 CAGAAATAGAAGAAAACTGTGGG + Intergenic
1143597417 17:7923557-7923579 GAGGAAAAAAAGAGGACTGATGG + Intronic
1143956338 17:10672987-10673009 AAGAAAAAAAAGAAAAATTAGGG - Exonic
1144071459 17:11675877-11675899 GAAAAAAAAAAGAAAATTGAAGG - Intronic
1144473616 17:15565361-15565383 CATCAAAATAAGAAAACAGAAGG - Intergenic
1144564288 17:16347218-16347240 GAGAGAAATCAGACAGCTGAAGG + Intronic
1144922905 17:18779450-18779472 CATCAAAATAAGAAAACAGAAGG + Intergenic
1144930074 17:18851910-18851932 AAGAAAAAAAAAAAAACAGAAGG - Intronic
1146013040 17:29210933-29210955 AAAAAAAAAAAAAAAACTGATGG + Intergenic
1146197619 17:30826403-30826425 AAAACAAATAAGAAAATTGAAGG + Intergenic
1146418526 17:32660381-32660403 AAGAAATAAAAGAAACCTGAGGG - Intronic
1146464965 17:33079231-33079253 GAGATAGATAAGTAAACAGACGG + Intronic
1146468043 17:33102640-33102662 GAGAAAAATAAGAAAATCAGAGG - Intronic
1146541674 17:33701464-33701486 GAGAACTATAACAAAAATGATGG - Intronic
1146767767 17:35539390-35539412 AAGAAAGAAAAGAAAAATGAAGG + Intergenic
1146822693 17:35997379-35997401 GAGAAAAATAAGAATTGTTATGG + Intronic
1146997609 17:37334670-37334692 GAGAAAAATATGATAAGGGAGGG - Intronic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1147151489 17:38517571-38517593 GCAAAAACTAATAAAACTGAAGG + Intergenic
1147310500 17:39593283-39593305 GAGAAAAAAGAGAAAAGAGAAGG + Intergenic
1147509310 17:41053559-41053581 GTAAATAAAAAGAAAACTGAAGG - Intergenic
1147548782 17:41423282-41423304 GAGGAAAAGCAGCAAACTGAAGG - Intronic
1148273430 17:46282085-46282107 AACAAAAACAAAAAAACTGAAGG - Intronic
1148775121 17:50090906-50090928 AAGAAAAATAAAAAGATTGATGG + Intergenic
1148930956 17:51126949-51126971 AAAAAAAAAAAAAAAACTGAGGG - Intergenic
1149046114 17:52247267-52247289 GAGAAAAATAAGATATGTAAAGG + Intergenic
1149080295 17:52648225-52648247 GAGAAATAATAGAAACCTGATGG + Intergenic
1149085960 17:52716329-52716351 GAGAAAAAAAAGAATACAAAAGG - Intergenic
1149108929 17:53002768-53002790 AAGCAAAATAACAAAACTGGAGG + Intergenic
1149114828 17:53080541-53080563 GGGAAAAATTAGAAAATTTAGGG + Intergenic
1149174295 17:53851185-53851207 TGGAAAAATCAGAAAACAGATGG - Intergenic
1149235497 17:54585590-54585612 AAGAAAAAAAAGAAAACTACAGG + Intergenic
1149275005 17:55024024-55024046 TACAAAAGTAAAAAAACTGATGG + Intronic
1149332379 17:55597876-55597898 GAGAATAAAAACAAAGCTGAAGG - Intergenic
1149429320 17:56584728-56584750 AAGAAAAATAAAAAAACAGTTGG + Intergenic
1149601310 17:57894706-57894728 GAGAAAAATTAGAAAAGAAAAGG - Intronic
1149752414 17:59158727-59158749 GACAAAAATGAAAAAAGTGAAGG + Intronic
1150074213 17:62178966-62178988 GAGACCAATAAGAACCCTGAAGG - Intergenic
1150184187 17:63162305-63162327 AAAAAAAAAAACAAAACTGAGGG + Intronic
1150377626 17:64694925-64694947 GAAAAAGAAAAGAAAACTCAGGG + Intergenic
1150409628 17:64932476-64932498 AACAAAAACAAAAAAACTGAAGG + Intergenic
1150412217 17:64954952-64954974 TAAATAAATAAGGAAACTGAAGG + Intergenic
1150490011 17:65567898-65567920 GAGCAAAATAAGATATCAGAAGG - Intronic
1150506647 17:65705568-65705590 GAGAACAAAAAGAAAAAGGAAGG + Intronic
1150753548 17:67889226-67889248 GAGAAAAAGAACTAAACTGAGGG - Intronic
1150777049 17:68089582-68089604 GAAAAAGAAAAGAAAACTCAGGG - Intergenic
1151228233 17:72662444-72662466 AAGAAAAAAAAGAAAAAGGAAGG + Intronic
1151240850 17:72756822-72756844 GAGAAAAAAAACTAAAATGAAGG + Intronic
1151768445 17:76144320-76144342 GAGAAAAAAAAAAAAAAAGAAGG - Exonic
1151770892 17:76160182-76160204 GAGAATAGTTAGAAAACTTAGGG - Intronic
1153114193 18:1634578-1634600 GAAAAAAAGAAGAAAATTGGAGG + Intergenic
1153426141 18:4966347-4966369 GAGAAAAAGAACAAAACTGGAGG + Intergenic
1153461922 18:5344870-5344892 AAGAAAAATAGGAAAAATTAGGG + Intergenic
1153766959 18:8384119-8384141 GAGAAAGAAAAGAAAACAAAGGG + Intronic
1153978988 18:10293532-10293554 GAGAAAAAGAAGAAAAGGGGAGG + Intergenic
1154153633 18:11927058-11927080 AAGAAAAAAAAAACAACTGAGGG + Intergenic
1154263063 18:12854824-12854846 GAGGAAAATCAGAAAAATTACGG + Intronic
1154930503 18:20990225-20990247 CAAAGAAATGAGAAAACTGAGGG + Intronic
1155018763 18:21874603-21874625 AATAAAAAAAAGAAAACTGCAGG + Intergenic
1155433313 18:25784909-25784931 GAGAAAAAGAAAAAAATTAAGGG + Intergenic
1155550928 18:26964340-26964362 GAGAGAAATAATAAAACAGGTGG - Intronic
1155666957 18:28321418-28321440 TAGAAAAACAAGAAAAATTATGG - Intergenic
1155813417 18:30270083-30270105 GAGATAAATAAAAATATTGACGG + Intergenic
1155981355 18:32183613-32183635 GAGAAAAAAAAAAAGACTGAGGG - Intronic
1156082135 18:33350034-33350056 GAAATAAATATGAAAACTAAAGG - Intronic
1156090279 18:33459913-33459935 AAGAAAAATAAGAGAAGTTAAGG + Intergenic
1156335168 18:36165041-36165063 GATACAACTAAGAAAACTCATGG + Intronic
1156618586 18:38820710-38820732 GTGAAAAAGAACAAAACTGTAGG + Intergenic
1156753863 18:40496098-40496120 TAGAAAGATAAGAAAAGAGAAGG - Intergenic
1156810612 18:41245309-41245331 GAAAAAAATAAGCAAACTCCAGG + Intergenic
1156931210 18:42646226-42646248 GAGAAAAAAAAGAAAAGAGAGGG + Intergenic
1156957674 18:42988358-42988380 GAGAAAAATAAGAAAATTATTGG - Intronic
1156968504 18:43126519-43126541 GAGAAAAATGATAGAGCTGAAGG + Intergenic
1157038265 18:44004457-44004479 GAGCAAAATAATAAAGCTGGAGG + Intergenic
1157160173 18:45306883-45306905 GAGAAAAAAATGAGAACAGATGG - Intronic
1157251429 18:46099427-46099449 TAAAAAAAAAAGAAAAGTGAAGG - Intronic
1157505926 18:48226511-48226533 TTCAAAAATGAGAAAACTGAGGG + Intronic
1157663063 18:49462475-49462497 CAGAAAAATTAGAAAACATAGGG - Intergenic
1157958715 18:52128155-52128177 TAGAAAAATAAGAACAGTGTAGG + Intergenic
1157959455 18:52136191-52136213 AAAAAAAAAAAAAAAACTGAAGG - Intergenic
1158043086 18:53121160-53121182 GAGAAAAATTAGAAAAGAGCCGG + Intronic
1158087506 18:53670042-53670064 GAGGAAAAGAAGAAAAAGGAGGG - Intergenic
1158098316 18:53800761-53800783 GTTAAAGATAAGAAAACTAAAGG + Intergenic
1158179748 18:54700684-54700706 GAGGAAAAGCAGAAAACTGGAGG + Intergenic
1158227637 18:55217349-55217371 TAGAAAAATCTGAAAACAGAAGG - Intergenic
1158267390 18:55675257-55675279 GAGCAAAAGAACAAAACTGGAGG - Intergenic
1158363279 18:56700984-56701006 AAGAAAATTAAAAAATCTGAAGG + Intronic
1158404449 18:57148648-57148670 TAGAAATATCAGAAAACTGACGG - Exonic
1158434056 18:57420973-57420995 AGCAAAAAGAAGAAAACTGAAGG + Intergenic
1158493580 18:57932488-57932510 AAAAAAAAAAAAAAAACTGAGGG + Intergenic
1158531476 18:58266382-58266404 GAAAAAAATAACTAAAATGAGGG + Intronic
1158656842 18:59344888-59344910 GATAACAATAAGAATAGTGATGG + Intronic
1158807782 18:60995728-60995750 GAGACAAATATGAAATCTGTAGG + Intergenic
1158808247 18:61000680-61000702 GAGTAAAATAAAAAAATTAAAGG - Intergenic
1159157790 18:64606771-64606793 GAGAAAAATGAGAAAATGGCTGG + Intergenic
1159375618 18:67588747-67588769 TAGAAAAATAAAAACACAGAGGG - Intergenic
1159572128 18:70127745-70127767 GACAAAAAGAAAAAAAATGAAGG + Intronic
1159573832 18:70151759-70151781 GAGAAAAATAAGACAATTTTAGG - Intronic
1159685559 18:71414743-71414765 GAAAAAAATCAGTAATCTGATGG + Intergenic
1159730988 18:72027492-72027514 GCAAAAAATAACAAAACTGGAGG - Intergenic
1159833220 18:73303948-73303970 GAGAAAAAAGAGAAAAATGATGG + Intergenic
1159969782 18:74635211-74635233 GTGAAAAAGAAGAAATCTGAGGG + Exonic
1159976630 18:74720920-74720942 AAGAAAAAAAAAAAAGCTGAAGG - Intronic
1161294747 19:3513957-3513979 GAAAAAAATATGAAAACAGTGGG + Intronic
1161357662 19:3827812-3827834 AATAAAAATAAGAAAAATAAAGG - Intronic
1161606660 19:5218832-5218854 GAAAAAAAGAAGAAAGGTGAGGG + Intronic
1161965954 19:7549171-7549193 AAGAAAAAAAAGAAACATGAAGG - Intronic
1162102133 19:8345534-8345556 TACAAAAATAAGAAACCTGCTGG - Intronic
1162249155 19:9427966-9427988 GAAAAAAAAAAGAAAACGGGGGG + Intronic
1162960309 19:14121819-14121841 AGTAAAAAAAAGAAAACTGAGGG - Intronic
1163199452 19:15754173-15754195 GAGAAAAAGAACAAACCTGAAGG - Intergenic
1163422741 19:17223635-17223657 AAGAAAAATAAGAAATGAGAAGG + Intergenic
1163532079 19:17855878-17855900 GTGAAAATTCGGAAAACTGATGG - Intergenic
1163723681 19:18910589-18910611 TAAATAAATAAGAAAACTGATGG + Intronic
1164068072 19:21738275-21738297 AAAAAAAAAAAAAAAACTGATGG + Intronic
1164096796 19:22017884-22017906 GAAAAAAAAAAGAATGCTGAAGG + Intergenic
1164240920 19:23388427-23388449 AAGCAAAACAACAAAACTGAAGG + Intronic
1164271232 19:23673900-23673922 TAGAACATTAAGAAAACTGTTGG + Intronic
1164557094 19:29261743-29261765 GAGAAAAATAAGAAAAAGACTGG + Intergenic
1164663149 19:29997059-29997081 GATAAAAATATGAAAACTACAGG - Intronic
1164767901 19:30785590-30785612 GAGTGAAATAAGAAAAGTCAAGG - Intergenic
1165186145 19:34023647-34023669 GAGAAAAATGTGAAAAATAAAGG - Intergenic
1165500014 19:36181413-36181435 AAAAAAAAAAAGTAAACTGAGGG + Intergenic
1165562290 19:36690122-36690144 GATAACAATTAGAAAACTCAGGG + Intronic
1165646963 19:37448492-37448514 GAGAAAAATCAGTGAACTAAAGG - Intronic
1166116197 19:40656269-40656291 GAGAAAAAAAAAAAAAAAGATGG + Intergenic
1166347567 19:42176079-42176101 GAGAAAAAAAAAAAAACAGGCGG + Intronic
1166875072 19:45891906-45891928 TAAAAAAATAAAAAAACTGTTGG - Intronic
1166880965 19:45929690-45929712 GAAAACAAAAAGAAATCTGAGGG - Intergenic
1166922099 19:46235916-46235938 GAGGCAAAAAAGAAAACTCAGGG + Intergenic
1167140319 19:47646116-47646138 GAAAGAAAAAAGAAAACTCAGGG + Intronic
1167275985 19:48539855-48539877 GACAAATATAATAAAACTGATGG + Intergenic
1167397980 19:49244038-49244060 AATAAAAATAAGAAAATAGAGGG - Intergenic
1167449621 19:49559512-49559534 AAAAAAAAAAAGAAACCTGAAGG + Intronic
1167553110 19:50174673-50174695 GAGAAAAATAACAAGAATGCAGG + Intergenic
1167993446 19:53380918-53380940 GACAAAAATCAAAAAATTGATGG + Exonic
1168086269 19:54049639-54049661 GAGAAAGATATGAAATCTAATGG - Intronic
1168256838 19:55171379-55171401 GAGAAAAATTAAAAATCTCATGG + Exonic
1168375018 19:55869724-55869746 GAGAAAAACAAAAAAGCAGACGG - Intronic
1168427660 19:56252241-56252263 GAGAGAAAAAGGAGAACTGATGG + Intronic
925449827 2:3959519-3959541 AAAAAAAAAAAAAAAACTGATGG - Intergenic
925455436 2:4012578-4012600 CAGAAAAATAAGAAAACTTCTGG + Intergenic
925740213 2:6999009-6999031 GACAACAATAACAAAAATGAAGG - Intronic
926489597 2:13507412-13507434 GAAAAAAATAAGTAAACTAAAGG - Intergenic
926546118 2:14242455-14242477 GAGTAAAATAAGAAAACTGATGG + Intergenic
926853124 2:17222788-17222810 GGGAAAAATAAGAAAATTTTTGG - Intergenic
927131522 2:20064412-20064434 GGAAAAAATTAGAAGACTGAGGG - Intergenic
927300771 2:21511366-21511388 CATAAAAATAAGAATACTCATGG - Intergenic
927402519 2:22729451-22729473 GACAAAAATGACAAAACTCAAGG - Intergenic
927425641 2:22978630-22978652 GAGAGAAGGAAGAAAAATGAAGG + Intergenic
927593801 2:24379636-24379658 AAAAAAAAAAAAAAAACTGATGG - Intergenic
927755196 2:25702635-25702657 AAGAAAAAAAAAAAAACTCAAGG - Intergenic
927827926 2:26322305-26322327 AAGAAAAAAAAGAAAGCTGATGG + Intronic
927835726 2:26397063-26397085 GAAAAGAAGAAGAAAATTGAAGG - Intergenic
928191332 2:29172003-29172025 GAAAAAAAAAAAAAAACAGAGGG - Intronic
928357040 2:30626678-30626700 GAGAAAAAAAAGAATACAAATGG - Intronic
928584253 2:32742292-32742314 GAGAAAAATAGGCAAAATAATGG + Intronic
928661082 2:33502371-33502393 GAGCAAATTAAGACAAATGAAGG - Intronic
928679456 2:33685164-33685186 AACAAAAAAAAGAAAACTAAAGG - Intergenic
928756764 2:34535489-34535511 GACAAAAATAGGAAAACAGGAGG + Intergenic
928806775 2:35167573-35167595 GAGAAAAATTGGAAAACAAATGG + Intergenic
929288330 2:40161664-40161686 GAGAAAACTAAGTAAGCAGATGG + Intronic
929553520 2:42909173-42909195 GGAAAGAAGAAGAAAACTGAGGG + Intergenic
929961067 2:46496697-46496719 AAAAAAAAAAAGAAAACTGTAGG + Intronic
930155112 2:48098920-48098942 GAGAAAATTTAGGAAACTTATGG + Intergenic
930164755 2:48194197-48194219 GTGTAAAATAAGAAAACAGAGGG + Intergenic
930320646 2:49850624-49850646 CACACATATAAGAAAACTGAAGG + Intergenic
930453023 2:51567583-51567605 GAAAAAAAGAACAAAGCTGAAGG - Intergenic
930490454 2:52062667-52062689 GAGAAAAAAGAATAAACTGAAGG + Intergenic
930498037 2:52173787-52173809 GAGAATCACAATAAAACTGAGGG + Intergenic
930608163 2:53513803-53513825 GAGAGAAAAAAAAAAGCTGATGG - Intergenic
930820484 2:55641656-55641678 GTGAAAAATAAGAAATGGGATGG - Intronic
931077056 2:58727111-58727133 ATAAAAAATAAAAAAACTGAAGG - Intergenic
931115080 2:59157023-59157045 GAGGAAGAAAACAAAACTGAAGG + Intergenic
931273045 2:60719478-60719500 GAGAAAAAAAAGAAATGTCAGGG + Intergenic
931328755 2:61257384-61257406 GATAAAAATAAGAAAATTATAGG + Intronic
931337194 2:61358235-61358257 GAGAAAACTAACAAAACCAAAGG + Intronic
931372467 2:61676615-61676637 ATGCAAAATAAGGAAACTGATGG - Intergenic
931409704 2:62017679-62017701 GAAAAAAAAAAGAAAAATGAAGG + Intronic
931572732 2:63686638-63686660 AGCAAAAAGAAGAAAACTGAAGG + Intronic
931893085 2:66696844-66696866 AAGAAGAAGAAGCAAACTGATGG + Intergenic
932015826 2:68024846-68024868 GAGAAAAAGAACAGAACTGGAGG - Intergenic
932092744 2:68821068-68821090 AAGAAAAAGAAAAGAACTGAAGG - Intronic
932321411 2:70824631-70824653 AAAAAAAAAAAAAAAACTGAGGG + Intergenic
932936235 2:76105598-76105620 AAGAAAAATAACAAAATTGTTGG - Intergenic
933084695 2:78040886-78040908 GAGAGAAAGAAGAAGACTGTTGG + Intergenic
933098384 2:78217883-78217905 CAAAAAAATAAGAAAACTAAAGG + Intergenic
933142941 2:78816308-78816330 GAGAAAAAGGATAAAACAGAAGG + Intergenic
933339213 2:81000419-81000441 GAGCAAAAAAACAAAACTGGAGG - Intergenic
933495955 2:83050727-83050749 AAAAAAAAAAAGAAAACTAATGG + Intergenic
933528820 2:83479041-83479063 ATGAAAAATGAGAAAATTGAGGG - Intergenic
933538837 2:83613124-83613146 GTAAAAAATAACAAAACTGCTGG - Intergenic
933602732 2:84349435-84349457 CAGAAAAAGAAAAAAACTGTGGG + Intergenic
934684694 2:96312219-96312241 GAGAAAAAGAAGAAGCATGAAGG + Intergenic
934934460 2:98454605-98454627 GTGAAAAATAAGAGTACTGTGGG - Intronic
935281034 2:101518041-101518063 AAAAAAAAAAAGACAACTGAGGG + Intergenic
935325600 2:101933693-101933715 GAGAAAAAGAAAAAAAAAGAAGG + Intergenic
935326433 2:101941695-101941717 TAAAAAAAAAAGAAAACTCAGGG + Intergenic
935352314 2:102162459-102162481 GAAAAAAATAACAGAATTGATGG - Intronic
935486825 2:103666595-103666617 AAGAAATATCAGAAAACGGATGG + Intergenic
935835055 2:107041705-107041727 GGCAAAAAGAATAAAACTGAAGG + Intergenic
935851943 2:107231278-107231300 TACAAAAATAATAACACTGAGGG - Intergenic
935873255 2:107475038-107475060 GAAAAAAAAAAAAAAACTTAAGG + Intergenic
935917719 2:107974061-107974083 GAAAAAAATAAACAAAATGAAGG + Intergenic
935935640 2:108179867-108179889 GAGAAAAATAACAAAACAGTTGG + Intergenic
936538340 2:113329668-113329690 GGAAATAATGAGAAAACTGATGG - Intergenic
936738980 2:115481039-115481061 GACAAAATTAAGAAAACCCAGGG + Intronic
937172300 2:119886967-119886989 AAAAAAAAAAAGAAAGCTGAAGG - Intronic
937530203 2:122819112-122819134 GAGAAAAATAATAAAAATGTTGG + Intergenic
937715986 2:125033269-125033291 GAGAAAAAGAAGAAATCTGGAGG - Intergenic
937927586 2:127178993-127179015 CAGAAAAGTAAAAAGACTGAAGG + Intergenic
938075497 2:128331317-128331339 GAGAAAACAAAGCAAATTGATGG - Intergenic
938514880 2:131993211-131993233 GAGAAAACTTAGAAATATGAAGG - Intergenic
938944374 2:136198124-136198146 AGCAAAAAGAAGAAAACTGAAGG - Intergenic
939079933 2:137647508-137647530 AAGACAAAGAAGAAAAGTGAAGG - Intronic
939111532 2:138013608-138013630 GAGAAAAATAAGTAAATATATGG - Intronic
939463709 2:142530463-142530485 GAGAAAAAGAAAAAAAAAGAGGG - Intergenic
939467302 2:142574855-142574877 AAGAAATATCAGAAAAGTGAAGG + Intergenic
939552416 2:143631978-143632000 GAGAAAAATTAGACACCTTAAGG - Intronic
939591357 2:144067454-144067476 GAGGACAATAAGAAATTTGATGG + Intronic
939645216 2:144689406-144689428 AAGAAAAAAAAAAAAACTTAGGG + Intergenic
939711388 2:145524625-145524647 GAGAAACAAAACGAAACTGAAGG + Intergenic
939815117 2:146886063-146886085 GAGAAAAATGATAAAACAAATGG + Intergenic
939818319 2:146923738-146923760 ACAAAAAATAAGAAAAATGAAGG + Intergenic
940074950 2:149731432-149731454 GGGAAAAAAAGGAAACCTGAAGG + Intergenic
940199427 2:151133580-151133602 GACAAAAAAGAGAAAACTGAGGG + Intergenic
940369270 2:152881901-152881923 GAGAAAAAGAAGAATCTTGAAGG - Intergenic
940486441 2:154302323-154302345 GAGAAAAATAAGGATACAAAAGG + Intronic
940587510 2:155672034-155672056 GAGAAAAAGAACAAGACTAAAGG - Intergenic
940956686 2:159736550-159736572 TAAAAAAATAAAAAAACTTAAGG - Intronic
940990506 2:160091830-160091852 GCCAAAAATAAGAGTACTGATGG - Intergenic
941295123 2:163728582-163728604 GAGTTGAGTAAGAAAACTGATGG - Intronic
941523259 2:166575541-166575563 GAGAAAAAAAAGCAAATTGGAGG + Intergenic
941527307 2:166622267-166622289 GAGCAAAAGAACAAAACTGGAGG - Intergenic
941545509 2:166845653-166845675 GAGCAAGATAATAAATCTGAGGG + Intergenic
941810123 2:169747393-169747415 AAAAAAAAAAAAAAAACTGAGGG + Intronic
941876622 2:170440222-170440244 GAGAAAAAGAATAAAGCTGGAGG - Intronic
942001074 2:171647417-171647439 CAGAAAAATAAAAAAATCGAGGG - Intergenic
942535149 2:176955586-176955608 AAGAAAAATAAAATCACTGAAGG + Intergenic
942590082 2:177534555-177534577 AAGAAAAGAAAGAAAACTAATGG - Intronic
942615026 2:177782795-177782817 GAGAAAGAGAAGAAAAAGGAGGG - Intronic
942782443 2:179661117-179661139 GTTAAAAATAGGAAAACTGAGGG + Intronic
942804363 2:179912287-179912309 GAGAAAAACAACACAAATGAAGG + Intergenic
942851514 2:180493472-180493494 GAAAAAAATAACAAAGCTGAAGG - Intergenic
942914335 2:181284995-181285017 AAAAAAAATTAGAAAACTGCAGG - Intergenic
943149643 2:184095871-184095893 CAAAAAAATAAGAAAACTACAGG - Intergenic
943196678 2:184761325-184761347 GAAAGAGATAAGAAAACTGAAGG - Intronic
943322962 2:186468230-186468252 GAGATAAATAGGAAAACAGATGG + Intergenic
943350099 2:186786587-186786609 GAGGAATATAAGTAACCTGATGG + Intergenic
943469624 2:188277406-188277428 CTGAAATAGAAGAAAACTGAGGG + Intergenic
943716542 2:191159040-191159062 GAGATTAATAAAAAAAGTGAAGG + Intergenic
943832073 2:192476141-192476163 AACAAAAAGAACAAAACTGAAGG + Intergenic
943845465 2:192640297-192640319 GAGCAAAAGAACAAAACTGGAGG + Intergenic
943913532 2:193598621-193598643 AAGAAGAAGAAGAAAACTGCAGG + Intergenic
943934046 2:193891719-193891741 GGGAAAAATAAGATAACTACAGG + Intergenic
943941641 2:194005635-194005657 GAGAAAAATAATTGAACAGAAGG - Intergenic
944028969 2:195209341-195209363 GAAAAAAACTACAAAACTGATGG - Intergenic
944056878 2:195531462-195531484 TACAAAAATAAGAAAACAAATGG - Intergenic
944321158 2:198344235-198344257 TAGAAAAATAAAAAAACTTTAGG + Intronic
944389391 2:199201527-199201549 AAGAAAAATAAAAAAGCTGTTGG - Intergenic
944494123 2:200289204-200289226 GAGAAGCATGAGAAGACTGAAGG - Intergenic
944655107 2:201869560-201869582 AAAAAAAGAAAGAAAACTGAGGG + Intronic
944923840 2:204442939-204442961 GAGCAGGATTAGAAAACTGAAGG - Intergenic
944973603 2:205022497-205022519 GAGAAAAAGAACAATATTGAAGG - Intronic
945425751 2:209698511-209698533 GAGAAAATCAAGGTAACTGATGG + Intronic
945460017 2:210095505-210095527 AAGAATAATAATAACACTGAAGG - Intronic
945485029 2:210384920-210384942 TAGAAAAATGAGGGAACTGAAGG - Intergenic
945502691 2:210596446-210596468 AAGAAAAATAAGAAAACCTTTGG - Intronic
945732812 2:213561752-213561774 GATAAAAATAATAAAAATAAAGG - Intronic
945840713 2:214884563-214884585 TAGAAAAATAAGAAAAAGAAAGG - Intergenic
946082518 2:217134855-217134877 AAGAAAAAAAAGAAAACTTCGGG - Intergenic
946512475 2:220373920-220373942 GAGTAAAATAGGAAAACAAATGG + Intergenic
946537247 2:220645210-220645232 GACAAAAAGAAGAACAATGATGG - Intergenic
946587030 2:221201222-221201244 GAGAAAATTGAGAATGCTGAAGG + Intergenic
946794468 2:223335207-223335229 AAGAAAAAGAAGAAAGCTGGAGG + Intergenic
946812455 2:223540301-223540323 GAGAAAAAAAAGAAAAGAGAAGG + Intergenic
947043087 2:225947031-225947053 AAGAAAAATAAGAAATGAGAAGG + Intergenic
947305982 2:228747918-228747940 CAGAAAAAAAAAAAAACTGCGGG - Intergenic
947408126 2:229802634-229802656 GAAAAAAATATAAAAACTAAAGG + Intronic
947493866 2:230618895-230618917 GAGAAAGAGAAGAAAAGAGAAGG + Intergenic
947989928 2:234478778-234478800 AAAAAAAATAAGATAACTGAGGG - Intergenic
948194543 2:236085593-236085615 GAGAGAAATGAGAAAAAAGAAGG - Intronic
948959327 2:241319892-241319914 GAAAACAGTAAGAAAACTGCTGG - Intronic
949012858 2:241691449-241691471 AACAAAAACAAAAAAACTGAAGG + Intergenic
1168940184 20:1704062-1704084 GAGCAAAAGAAGAAAGCTGGAGG + Intergenic
1169242410 20:3995239-3995261 GAGAACAAAAAGAGACCTGATGG - Intronic
1169342494 20:4806810-4806832 GAGAAAAATAAGGAAATGGAGGG - Intronic
1169419852 20:5451175-5451197 AAGAAAAAAAAGAAAACTATTGG + Intergenic
1170091972 20:12599120-12599142 GCAAAAAATAAGAAAAATGTTGG - Intergenic
1170115591 20:12855572-12855594 AACAAAAAGAAGAAAGCTGAAGG + Intergenic
1170169587 20:13395682-13395704 AAAAAAAAAAAGAAAGCTGAGGG - Intronic
1170780177 20:19418461-19418483 GAAAAAAATAAGAAAATTAGAGG + Intronic
1170895142 20:20406155-20406177 GAAAAAAAAGAAAAAACTGAGGG - Intronic
1171036818 20:21719341-21719363 AAGAAGAAAAAGAAAAGTGAAGG - Intergenic
1171064329 20:21998806-21998828 GAGCAAAATCAGAAAGCTGGAGG + Intergenic
1171287016 20:23948661-23948683 AACAAAAATAACAAAGCTGAAGG - Intergenic
1171337509 20:24397922-24397944 GAAAAAAAAAACAAAACTGGAGG - Intergenic
1171960442 20:31489887-31489909 GTGAAAAATAATAAAGCTGAAGG - Intergenic
1172170613 20:32929496-32929518 GAAAAAAAAAAAAAAACAGAAGG - Intronic
1172179676 20:32994393-32994415 GATAAAAAGCAGAAAACAGAGGG + Intronic
1172501433 20:35430810-35430832 AAAAAAAAGAAGAACACTGAGGG + Intergenic
1172651167 20:36502716-36502738 AATAAAAATAAAAAAAATGATGG - Intronic
1172766875 20:37355752-37355774 GAGAAAAAAAAGAAGGGTGAGGG + Intronic
1172833506 20:37856864-37856886 CAGAAAAATAAGGAAAATGGAGG - Intronic
1173277235 20:41595788-41595810 CAAAAAAAAAAGCAAACTGAGGG - Intronic
1173415567 20:42852618-42852640 GAGAAAAATCCTCAAACTGATGG - Intronic
1173470441 20:43319537-43319559 GAGAAAAATGTGCAAACTCAGGG - Intergenic
1173884242 20:46443225-46443247 GAGCAAAAAAAGAAAAAAGAAGG - Intergenic
1174642807 20:52059784-52059806 TTTAAAACTAAGAAAACTGAGGG + Intronic
1174803511 20:53585548-53585570 CAAAAAAATAAGAAATATGATGG + Intronic
1174848096 20:53963484-53963506 GAAAAAAAAAAGAAAAAGGAGGG + Intronic
1174954114 20:55077015-55077037 GAGAAAAATAAAAGAGCTAAAGG - Intergenic
1175287907 20:57850079-57850101 GAGAAGAATCGGAAAACTCAGGG - Intergenic
1175728729 20:61337381-61337403 GATAATGATAATAAAACTGATGG + Intronic
1175848834 20:62075924-62075946 GAGAAAAAAAAGAAAATTTCAGG + Intergenic
1176006657 20:62868098-62868120 GAAAAAAGAAAAAAAACTGAAGG + Intergenic
1176511896 21:7755097-7755119 CAGAGAAAAAAGATAACTGAAGG + Intronic
1176655336 21:9583825-9583847 GAGAACACAAAGAAAACTCAAGG - Intergenic
1176742534 21:10617174-10617196 GAGAAAAGAAAGAAAAAAGAAGG + Intergenic
1176893534 21:14348142-14348164 GAGAAATAGAAGAACACTAAGGG - Intergenic
1177346997 21:19886385-19886407 GAGCAAAAAAAAAAAACTGAGGG - Intergenic
1177382845 21:20367973-20367995 GAGAAAAATAAGAAAAAGTTAGG - Intergenic
1177467150 21:21500228-21500250 GAGAAAAAAGAGAAAAATCATGG - Intronic
1177633763 21:23759573-23759595 AAGCAAAACAAAAAAACTGATGG - Intergenic
1177647953 21:23923283-23923305 GAAATATATAAGAAAAATGAAGG - Intergenic
1178365908 21:31988636-31988658 GAGAAAAGAGAGAAAAATGAGGG - Intronic
1178646009 21:34385623-34385645 CAGAGAAAAAAGATAACTGAAGG + Exonic
1179396153 21:41041919-41041941 GAGAAGAAAAAGAAAACTACAGG + Intergenic
1179480738 21:41676670-41676692 GAAAGAAAAAAGAAAACTGACGG - Intergenic
1180178425 21:46103887-46103909 GAGGAAAAAGAGAAAAATGAAGG - Intronic
1181360669 22:22331798-22331820 GAGAAACATAAATAACCTGATGG + Intergenic
1182195064 22:28507204-28507226 GAGAAACATAACCAACCTGATGG + Intronic
1182229859 22:28829455-28829477 GAGAAAAATAAGCACAATGTAGG - Intergenic
1182313542 22:29426798-29426820 GACAAAAATAAGGAAACAGGAGG - Intergenic
1182758726 22:32703698-32703720 GAAAAAGAGAAGAAAACTGATGG + Intronic
1183004039 22:34885430-34885452 GAGAAAAAAAAAAAAACACAAGG - Intergenic
1183055943 22:35305659-35305681 AAAAAAAAAAAAAAAACTGATGG + Intronic
1183461683 22:37954762-37954784 GATAAAAATAAGAAACGTGTGGG + Intronic
1183562777 22:38589398-38589420 AAGAAAGATAAGAAAATTAAAGG + Intronic
1183757549 22:39783454-39783476 GAAAAAAAGAATAAAGCTGAAGG + Intronic
1183916463 22:41124460-41124482 TATAAAAAGTAGAAAACTGATGG - Intronic
1183999699 22:41664100-41664122 GAGAAAATTAAGCTAAGTGATGG - Intergenic
1184742597 22:46437753-46437775 AAAAAAAAAAAAAAAACTGATGG + Intronic
1184805324 22:46791707-46791729 GAGTAAATTTGGAAAACTGATGG - Intronic
1203322905 22_KI270737v1_random:85955-85977 GAGAAAAGGAAGAAAAGGGAGGG - Intergenic
949267250 3:2172557-2172579 AACAAAAAAAAGAAAACTGGTGG + Intronic
949282947 3:2367909-2367931 GAGAAAAATAATAGTACTTACGG - Intronic
949382108 3:3458138-3458160 GAGACAAATAAGAAAAACAATGG + Intergenic
949511474 3:4770667-4770689 AAGAAAACTAAGGAAACCGATGG - Intronic
949648078 3:6121413-6121435 AAAAAAAAAAAAAAAACTGAAGG - Intergenic
949738891 3:7207068-7207090 GAGAAATAGAAGAAAACAGAAGG + Intronic
949752099 3:7365099-7365121 CAGAAAAACCAGAAAACTGTGGG - Intronic
949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG + Intergenic
950458279 3:13105475-13105497 GAGAAAACCAAGAAAAATCAGGG + Intergenic
950524354 3:13514979-13515001 GAGAAAAAGAAAAAACATGATGG + Intergenic
950663299 3:14480359-14480381 GAGAGAGATAAGGAAACTGAGGG - Intronic
950938347 3:16866487-16866509 GAAAAACATAAGAACACTGGAGG - Intronic
950985431 3:17359063-17359085 TATAAAAATAAGAAATTTGAGGG + Intronic
951024634 3:17816415-17816437 CAAAACAATAAGAAAAATGAGGG + Intronic
951255448 3:20444313-20444335 AACAAAAAGAACAAAACTGAAGG + Intergenic
951293021 3:20897686-20897708 TTGAAAAATAAGAAAAATGTAGG + Intergenic
951418858 3:22459700-22459722 GAGAAAGAAAACAAAGCTGAAGG + Intergenic
951441158 3:22725728-22725750 GAGAAAAAAAAAAAAACTCAGGG - Intergenic
951443465 3:22749125-22749147 GAGCCAAAGAAGAAAACTTAAGG + Intergenic
951477873 3:23127503-23127525 GAGAGGAACAAGAGAACTGAGGG - Intergenic
951689400 3:25380126-25380148 GAGAAAAATCTGACAACTAATGG + Intronic
951699297 3:25478682-25478704 GAGAAAAAGAAGAAATCAGAAGG + Intronic
951838211 3:27005036-27005058 GAGAAAAATATGATAAGGGAGGG - Intergenic
951996451 3:28735611-28735633 GAGAAATATAACCAACCTGATGG - Intergenic
952184895 3:30957750-30957772 AAGAAAAACAAGAAAATTGGTGG + Intergenic
952218445 3:31300750-31300772 GTGGAAAATAGGAAAGCTGATGG - Intergenic
952341035 3:32447567-32447589 GTGAAAAATGAGAAAAATGAAGG - Intronic
952501138 3:33963156-33963178 GAGAAGAAAAAGATAAATGAAGG + Intergenic
952533667 3:34288343-34288365 GAGAAAAAAAAAAAGAGTGAAGG + Intergenic
952621625 3:35350625-35350647 AAGAAAAAAAGGAAAATTGACGG + Intergenic
952664709 3:35890292-35890314 AAGAAAAATAAGAAAATCAAGGG - Intergenic
952674091 3:36006038-36006060 AAGAAGAAGAAGAAAACTGAAGG + Intergenic
953237348 3:41118304-41118326 CAGAAAAACAAGAAAACAGTGGG - Intergenic
953374649 3:42418575-42418597 AATAAAAATAAGAAAAAGGAGGG + Intergenic
953445521 3:42961686-42961708 GAGAGAAATAAGATAAATAAAGG - Intronic
953844147 3:46413968-46413990 GGGAAAAAAAAGAAAACAAAGGG - Intergenic
954070738 3:48141214-48141236 GAAAAAAACAAAAAAACTGTTGG + Intergenic
954169561 3:48789917-48789939 GAGAAAAGAAAGAAAAGAGAGGG - Intronic
954492844 3:50923492-50923514 GAGAAACATTATAAAACTAAAGG - Intronic
954559692 3:51546338-51546360 CAGATAAAAAGGAAAACTGAAGG + Intronic
954824874 3:53363970-53363992 AAGAAAAAAAAGAAAAATCATGG - Intergenic
955162154 3:56474362-56474384 GAAAAAAATAACAAAATTCAGGG + Intergenic
955254147 3:57312465-57312487 AAGGCAAATCAGAAAACTGATGG - Intronic
955536291 3:59927465-59927487 AAAAAAAAAAAAAAAACTGAAGG + Intronic
955646634 3:61145550-61145572 GAAAAAAATAAAAAAACAGCTGG + Intronic
955713966 3:61809324-61809346 GAGAAAAATGTGATCACTGATGG + Intronic
955878125 3:63515136-63515158 GGCAGAAATAATAAAACTGACGG - Intronic
955941608 3:64151418-64151440 AAGAAAGAGAAGAAAACCGAGGG + Intronic
956003248 3:64751374-64751396 AATAAAAATAAAAAAAATGAGGG - Intergenic
956165477 3:66395341-66395363 GAGAAACAGAAGAAAATGGAAGG - Intronic
956271791 3:67455683-67455705 GAGGAAAAAAAAAACACTGATGG + Intronic
956360793 3:68444358-68444380 GAGAAAAAGAAGAAGACTTGAGG - Intronic
956492451 3:69787669-69787691 GAAAAAAAGAAAAAAAGTGAGGG - Intronic
956522952 3:70125759-70125781 GAGAAAAAAGAGAAAAATAAAGG - Intergenic
956573017 3:70718240-70718262 GATAAAATAAAGAAAACTGGTGG - Intergenic
956581210 3:70816107-70816129 GAGAAAAAAAAGTGAAGTGAAGG + Intergenic
957133542 3:76254751-76254773 GAGAGAACAAATAAAACTGAGGG + Intronic
957188442 3:76974296-76974318 AAGAAAAATAAGAAAAAGGGGGG - Intronic
957208757 3:77233318-77233340 GACAAAAATAAAAAAAGTGGAGG - Intronic
957255370 3:77829033-77829055 GAGGAAAAAAAGAAAAGAGAAGG - Intergenic
957346096 3:78963488-78963510 AAAAAAAAAAAAAAAACTGAAGG - Intronic
957445167 3:80307567-80307589 GAGAAAAAAAGAAAAACTGTAGG - Intergenic
957485931 3:80863063-80863085 GAAAAAAATAACAAAACTGGAGG + Intergenic
957503727 3:81092595-81092617 GATAAGAATAAGAACACTCATGG + Intergenic
957589993 3:82184350-82184372 CTGAAAAATCAGTAAACTGAAGG + Intergenic
957737929 3:84226199-84226221 GAGAAAAAAATGAAAAATGATGG + Intergenic
957743746 3:84310059-84310081 CAAAAAAATAAGTGAACTGATGG - Intergenic
958072922 3:88637813-88637835 GACAAAAAAAAGAAAACTTCAGG - Intergenic
958085634 3:88802708-88802730 AGCAAAAATAACAAAACTGAAGG - Intergenic
958494985 3:94833516-94833538 CAGCAAAATAAAAAAACTGGAGG + Intergenic
958495106 3:94835100-94835122 CAGCAAAATAAAAAAACTGGAGG - Intergenic
958524315 3:95234972-95234994 AAGAAAAATAAGAAGACAAAAGG + Intergenic
958558469 3:95710258-95710280 CAGAAAAAGAAGAAAAGAGAAGG + Intergenic
958629505 3:96668803-96668825 GAGAAAAATATGATAAGGGAGGG + Intergenic
958695245 3:97519423-97519445 GAGCAAAAGAATAAAGCTGAAGG - Intronic
958736718 3:98017993-98018015 AAAAAAAAAAAGAAAACTGGAGG - Intronic
958795013 3:98698086-98698108 GGGAACAATTAGAAAACTGCAGG + Intergenic
958806337 3:98815349-98815371 GAGAAAAATAAGAAAACTGAAGG + Intronic
958817332 3:98929955-98929977 GAGAAACATAACCAACCTGATGG + Intergenic
959251863 3:103958180-103958202 GATAATAATAAAAAAACTGGGGG + Intergenic
959452430 3:106520156-106520178 TAGAAAAAGAAGAAAAGAGAGGG + Intergenic
959471371 3:106755460-106755482 GGCAAAAAGAAGAAAACTGGAGG + Intergenic
959559005 3:107758295-107758317 CAGGCAAAAAAGAAAACTGAAGG + Intronic
959678922 3:109070331-109070353 GAGAAAAATAAAGAATCGGAAGG + Intronic
959709919 3:109375370-109375392 AACAAAAAAAAGAAAACAGAAGG - Intergenic
959916155 3:111818863-111818885 GGGAAAAGTAACAAAACTCATGG - Intronic
959963596 3:112330087-112330109 AAAAAAAATAATAAAACTAAAGG - Intergenic
960118294 3:113920509-113920531 GAGAAAAATAAATAAAATTAGGG + Intronic
960233600 3:115255956-115255978 GAGGAACATAAATAAACTGATGG + Intergenic
960500828 3:118436460-118436482 GAGAAAAAAAAAAAAACCTAGGG + Intergenic
960940933 3:122933704-122933726 GAGAAATATCAGAAAACTAGAGG - Intronic
961294003 3:125869508-125869530 AAAAAAAAAAAGAAAAATGAAGG - Intergenic
961442203 3:126959797-126959819 GTGAAAAATCAGAGAACAGAGGG + Intronic
961590234 3:127974233-127974255 AAGCAAAGAAAGAAAACTGATGG + Intronic
962243083 3:133767711-133767733 CAGAAAAAGATGAAGACTGAAGG - Intronic
962528992 3:136261369-136261391 GAGTAAAATGAGAAAAATTAAGG - Intronic
962577105 3:136764559-136764581 AAGAAAAAAAAGAGATCTGATGG + Intergenic
962596339 3:136948661-136948683 GAAAAAAACAATAAAACAGAAGG - Exonic
962651071 3:137492062-137492084 GAGAAAAGAAAGAAAACCCAAGG - Intergenic
962720428 3:138168967-138168989 AAAAAAAAGAAGAAAACTCATGG + Intronic
962938408 3:140102944-140102966 TTGAAAGGTAAGAAAACTGAGGG - Intronic
963089784 3:141472200-141472222 GTGAAAAACAACAAAACTGGAGG - Intergenic
963365421 3:144327931-144327953 AAGAAAAAAAGGAAAACTGTAGG + Intergenic
963411527 3:144933396-144933418 GTGAGCAATAAGAAATCTGATGG + Intergenic
963498646 3:146097372-146097394 GAAAAAATTGAGAAATCTGATGG + Intronic
963703742 3:148659538-148659560 GAGAAAATTAAGAATTATGAAGG - Intergenic
963855388 3:150247970-150247992 GAGAAGAAAAAGAAAGGTGAAGG - Intergenic
964090217 3:152866971-152866993 AAAAAAAATAAGTAAACTAAAGG - Intergenic
964103306 3:153013043-153013065 CTGAAAAATAAAAAAAATGAGGG + Intergenic
964249856 3:154700630-154700652 GAGAAAAATAAAAATAATAATGG + Intergenic
964398902 3:156278274-156278296 GAGAAAAATATCTAACCTGAAGG - Intronic
964579629 3:158218452-158218474 GATATAAATCAGAAAACTAATGG - Intronic
964832274 3:160897413-160897435 CAGAAGACTAAGAAAAGTGAAGG - Intronic
964882325 3:161437256-161437278 GAAAAAAGCAAGAAAACTGCTGG + Intergenic
964963925 3:162465519-162465541 GCAAAAAAAAAAAAAACTGAAGG + Intergenic
965072122 3:163927293-163927315 AACAAAAATAATAAACCTGAGGG - Intergenic
965117734 3:164513958-164513980 AGCAAAAATAACAAAACTGAAGG - Intergenic
965155416 3:165046681-165046703 GAGGAAAATAAGAATACAGATGG - Intronic
965191625 3:165537848-165537870 GAGGAAAATAAAAAAAGAGAGGG - Intergenic
965581587 3:170273829-170273851 GAAAAAAAAAAGACAACTGTGGG + Intronic
965811971 3:172600703-172600725 AAGAAAAAAAAGAAAATTCAAGG - Intergenic
965874960 3:173305616-173305638 GAAAAAAAAAAAAAAAATGAAGG - Intergenic
965889111 3:173488891-173488913 AAAAAAAAAAAGAAAGCTGAAGG - Intronic
965973732 3:174595217-174595239 GAGGAGAAAGAGAAAACTGATGG - Intronic
966072649 3:175897574-175897596 GAGAAAAATAGGAAAATCTAAGG + Intergenic
966446768 3:180009264-180009286 GAAAAATATAAGAAAAGTTAAGG - Intronic
966724588 3:183098234-183098256 GAGAAACATAAGAAAGTTGTTGG - Intronic
966990511 3:185225505-185225527 GACAAAAACAGGAAGACTGAGGG - Intronic
967456901 3:189698385-189698407 GAGAAAAATAAGAGAAAGGAAGG - Intronic
967494476 3:190127556-190127578 GAGATATTTAAGAAAAATGAGGG + Intergenic
967574827 3:191077344-191077366 GAGAGAAATTAGAAGACTGCTGG - Intergenic
967594331 3:191312502-191312524 GCAAAAAAAAAGTAAACTGATGG - Intronic
967598569 3:191357176-191357198 CACTAAAAAAAGAAAACTGAAGG - Intronic
967619324 3:191613556-191613578 GAGAGAAATAAGAATACAAATGG - Intergenic
967738038 3:192974501-192974523 AAATAAAATAAGTAAACTGATGG - Intergenic
967938945 3:194751275-194751297 AAGAAAAAAAAGAAAAAAGAAGG + Intergenic
968050329 3:195649657-195649679 GACCAAAATATGAAAACTGCTGG + Intergenic
968237811 3:197047410-197047432 GAAAAAAATAAGAAAGCACAAGG + Intronic
968252797 3:197237298-197237320 GAGGTAAAAAAGAAAACTCAGGG - Intronic
968252949 3:197238964-197238986 GAAAAAAATAATAAAGATGAGGG + Intronic
968303778 3:197636217-197636239 GACCAAAATATGAAAACTGCTGG - Intergenic
969894629 4:10291954-10291976 GAGAAAAATAAGCAATATGGGGG + Intergenic
969966267 4:10999985-11000007 TTGACAGATAAGAAAACTGAGGG + Intergenic
970050298 4:11906619-11906641 GAGAAAAATAAGAAAGAAAAGGG + Intergenic
970072675 4:12179259-12179281 AAGAAAAAGAAAAAAACTGCAGG + Intergenic
970181806 4:13405932-13405954 TAGAAAAATGAGAAAACTATGGG + Intronic
970290496 4:14565913-14565935 GAGAAAGAAGAGAAAAATGAAGG - Intergenic
970300255 4:14673618-14673640 GAGAGAAATAGAAAAATTGAAGG + Intergenic
970460821 4:16273087-16273109 CAAGAAAAAAAGAAAACTGAAGG - Intergenic
970548258 4:17152117-17152139 GCTATACATAAGAAAACTGATGG - Intergenic
970804764 4:20017885-20017907 GAGAAAAAAAAAAAGACAGATGG - Intergenic
970928223 4:21477916-21477938 GAGAAAAATAAGAGAATAAAAGG - Intronic
971523568 4:27586509-27586531 GAGACAAAGAATAAAACTGGAGG + Intergenic
971613872 4:28762258-28762280 GAAACAAACAAGAAAACTAATGG - Intergenic
971689017 4:29809242-29809264 GAGCTAAATTTGAAAACTGAAGG - Intergenic
971703049 4:30005712-30005734 GAGAAAAAAAAGAAGAATGTTGG - Intergenic
971929312 4:33059361-33059383 GAGTAAATTAAGAGCACTGAAGG + Intergenic
972007558 4:34129943-34129965 GAGGAAAAAAAAAAAACTGGAGG + Intergenic
972014709 4:34228730-34228752 AAAAAAGATAAGAAAACTAAAGG - Intergenic
972070372 4:35012044-35012066 GAGAAAAAGAATAACACAGATGG - Intergenic
972083087 4:35178660-35178682 AAAAAAAATAAAAAAACAGAAGG + Intergenic
972145686 4:36021776-36021798 GAGAAAAATAAGAGAACCATTGG + Intronic
972236588 4:37141203-37141225 GATAAAAAAAAAAAAACTAAAGG + Intergenic
972506511 4:39724923-39724945 AACAAAAATAAGAACACTGGAGG - Intronic
972713478 4:41622267-41622289 GACAAAAATAATAATAGTGAGGG + Intronic
972858134 4:43132789-43132811 GAGAAATTCAGGAAAACTGAGGG - Intergenic
973006197 4:45009825-45009847 GAGAAAAATAAGAACAGTAAGGG + Intergenic
973065099 4:45780186-45780208 TAGAAAGATAAGAAAATAGAAGG - Intergenic
973917046 4:55644927-55644949 GAGCAAAATAACAAAACTGGAGG - Intergenic
974104163 4:57449043-57449065 GAGAAAAAGAACAAAGCTGGAGG - Intergenic
974252212 4:59401031-59401053 GTAAAACAAAAGAAAACTGAAGG - Intergenic
974325302 4:60406677-60406699 GAGAAAAATGAGAACTCAGAAGG - Intergenic
974396389 4:61341122-61341144 GAGCAAAAGAAGAAAAATGAAGG - Intronic
974435460 4:61852074-61852096 GTGGAAAATAGCAAAACTGAGGG + Intronic
974499849 4:62685126-62685148 GAGAAACATAAATAACCTGATGG + Intergenic
974501882 4:62715555-62715577 AACAAAAAAAAGAAAACTGCAGG - Intergenic
974645257 4:64681530-64681552 AATAACAATAAGAATACTGATGG + Intergenic
974731632 4:65874171-65874193 GATAAAAAGAAGAAAAATGGAGG + Intergenic
974869688 4:67625305-67625327 GAGAAACATAAGAAAAATTCAGG + Intronic
975016437 4:69426579-69426601 AAGAAAAAGAAGAAATCTGTAGG - Intergenic
975064510 4:70043486-70043508 GAGAAGAGTCAGAACACTGAAGG - Intergenic
975074145 4:70183762-70183784 GAAAAAAAGAATAACACTGAAGG + Intergenic
975268039 4:72394265-72394287 GAGAGGAAAAAAAAAACTGATGG + Intronic
975313505 4:72928082-72928104 GAGAAAAATATGATAAGGGAGGG + Intergenic
975333429 4:73146652-73146674 AAAAAAAACAATAAAACTGAAGG + Intronic
975455083 4:74580994-74581016 AAGAAAAATAACAAAAATAAAGG + Intergenic
975727845 4:77309280-77309302 GAGAAAATCAGGAAAACTAATGG - Intronic
975809493 4:78151847-78151869 TAGAAAGATAAGAAAGATGAAGG - Intronic
975872093 4:78791006-78791028 GAGAAAAATCAAATAACTGATGG - Intronic
976532097 4:86167409-86167431 TAGCAAAAAAAGAAAACTTAAGG + Intronic
976548115 4:86361248-86361270 GAGAAAATTTAGAAAAAGGAAGG + Intronic
976615852 4:87076035-87076057 GAGAAAGATTAGAACACTAAGGG + Intronic
976650559 4:87429586-87429608 AAAAAGGATAAGAAAACTGAAGG - Intronic
976693169 4:87890425-87890447 AATAAAAAAAAGAAAACTTAAGG + Intergenic
976954057 4:90872519-90872541 ACAAAAAGTAAGAAAACTGATGG - Intronic
977117226 4:93045359-93045381 GAGTAAAACCATAAAACTGAGGG - Intronic
977147663 4:93465554-93465576 GAGAAAATTAAAAGAACTCATGG + Intronic
977214064 4:94258142-94258164 AAGAAAAAAAAAAAATCTGATGG - Intronic
977231894 4:94461593-94461615 CAAAAAAATAAGAAAGGTGAAGG - Intronic
977293367 4:95187032-95187054 GAGAAGAAGAAGAAAAGTGAGGG + Intronic
977301945 4:95277923-95277945 AAGAACAATAATAAAATTGATGG + Intronic
977506815 4:97912465-97912487 GAGAAACATAACCAACCTGATGG + Intronic
977719184 4:100219464-100219486 AAGAAAAAAAAGAAAACTACAGG - Intergenic
977879545 4:102188274-102188296 GAAAAAAATAAGGAATATGATGG - Intergenic
978417804 4:108496406-108496428 AATAAAAAAAAGAAAACTAAAGG + Intergenic
978523500 4:109640626-109640648 GAGAGAAATGAGAGAACTGTAGG - Intronic
978541165 4:109817468-109817490 GAGAAAAAAAAAAAGAATGAAGG + Intronic
978586243 4:110278901-110278923 GAGAAAAATATGATAAGGGAGGG + Intergenic
978639077 4:110847373-110847395 GAGACAAATAAGAACATTTATGG + Intergenic
978727068 4:111981682-111981704 CTCACAAATAAGAAAACTGAAGG + Intergenic
978887774 4:113785361-113785383 GACAAAAATAGAAAAAATGAAGG + Intergenic
978961723 4:114687539-114687561 AAAAAAAACAAAAAAACTGAGGG - Intergenic
979027355 4:115594493-115594515 GAAATAAATAAGAAAACAAATGG - Intergenic
979106660 4:116697720-116697742 GGAAAAAAAAAAAAAACTGATGG + Intergenic
979282963 4:118888078-118888100 TATAAAAATAAGAAACCTGTAGG + Intronic
979286326 4:118929078-118929100 GAAAAAAAAAAGAAAAAGGAAGG + Intronic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
979701200 4:123669682-123669704 GAGAAAAAGAAGAAAAGGAAGGG - Intergenic
979769210 4:124501768-124501790 CAGTATAATGAGAAAACTGAAGG - Intergenic
980029105 4:127804786-127804808 GGTAGAAATAAGAAAATTGAAGG + Intronic
980267926 4:130543929-130543951 GAGTAATATAAGCAAAGTGATGG + Intergenic
980268841 4:130557358-130557380 AAGCAAAAGAAGAAAACTGGAGG + Intergenic
980340949 4:131546888-131546910 GACAAAAATAAGTAAAATGTAGG - Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980624931 4:135362679-135362701 GAAAAAAATAAAAAAAATCAAGG + Intergenic
980833608 4:138161876-138161898 GAGAACATTAAGTAAGCTGAAGG + Intergenic
981058445 4:140392236-140392258 GAGGAAAAAAAGCAAAATGATGG - Exonic
981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG + Intronic
981127811 4:141126823-141126845 TTTATAAATAAGAAAACTGAGGG + Intronic
981212261 4:142121557-142121579 GAAATAATTAAGAAAAATGATGG - Intronic
981215571 4:142162310-142162332 GAAAGATATAAAAAAACTGATGG + Intronic
981235339 4:142408939-142408961 GGGAAAAATAATAATACAGAAGG + Intronic
981302886 4:143209849-143209871 GAGAAAAATATAAAAACTTAGGG - Intronic
981402261 4:144327154-144327176 GAAAAAAAGAAAAAAACTAAAGG + Intergenic
981498236 4:145417449-145417471 GAAAAAAGTAAGAAAAAAGAAGG + Intergenic
981559298 4:146029521-146029543 GAGGAAAATAAAACAACTAAAGG - Intergenic
981910231 4:149971276-149971298 AAGAAAAATAAAAAAGTTGAAGG + Intergenic
982058071 4:151573561-151573583 GAGAAAAAAAACAAAATTAATGG - Intronic
982294520 4:153813455-153813477 GAAAAAAAAAAGAAAACCTAGGG + Intergenic
982434073 4:155361834-155361856 GAGACAAATAATATAACTTAGGG + Intronic
982531014 4:156543935-156543957 CAGAAAAAAAAAACAACTGAAGG + Intergenic
982590120 4:157298180-157298202 GAGAAAGAAAAGGAAAGTGAAGG + Intronic
982857346 4:160400855-160400877 GAGAATGTTAAGAAAACTAATGG - Intergenic
983002151 4:162429783-162429805 GAGAAAAATAGGTAAAATAAAGG + Intergenic
983116288 4:163820581-163820603 GAGAAAGATAGTAAAACTGATGG - Intronic
983156806 4:164357986-164358008 GAGAAACATAAGAGAAGTAAAGG + Intronic
983224003 4:165069416-165069438 AAAAAAAAAAAGAAAACAGATGG - Intergenic
983290367 4:165795902-165795924 GAGAAAAATAATAAATATGAAGG - Intergenic
983314483 4:166112907-166112929 GAGAAAAAAAGCAAAACCGAAGG - Intergenic
983376465 4:166934914-166934936 GAAAAGAAAAAAAAAACTGAAGG + Intronic
983426902 4:167596586-167596608 AAGTAAAATAAGAAATCTAAAGG - Intergenic
983454416 4:167944796-167944818 TAGAAAAATTAGATAACTAACGG - Intergenic
983703820 4:170632561-170632583 GAGAAAAAAAAGCTAACTGCTGG - Intergenic
983727948 4:170953587-170953609 GAGAAAAAAATAAAAAATGATGG - Intergenic
983741804 4:171143618-171143640 GAGAAAAATAACAAGAAAGAAGG - Intergenic
983754558 4:171319063-171319085 TAAAAAAATAAGAAAATTTATGG - Intergenic
983832349 4:172342924-172342946 GATATAAATGAGAACACTGATGG - Intronic
984074931 4:175164525-175164547 GAGAAAAAAAAAAAAACCCAGGG + Intergenic
984090427 4:175367724-175367746 GAGAGAAAGAAGAAAAATAAGGG - Intergenic
984147027 4:176074325-176074347 GAGAAAAATAAAAATAATGGAGG - Intronic
984301316 4:177922159-177922181 CAGAAGAATAAGAAAACTCATGG - Intronic
984415137 4:179448123-179448145 GAGGAAATCAAGAAAAGTGAGGG + Intergenic
984783000 4:183542844-183542866 AAGAAAAAAAACAAAACTGCAGG + Intergenic
984797278 4:183673979-183674001 TAAAAGAATAAGAAAACTAATGG - Intronic
984854320 4:184180551-184180573 AAGAAAAAAAAGAAAACTTCAGG + Intronic
984913588 4:184699536-184699558 GGCCAAAATAAGAAAACTAAAGG - Intronic
985172906 4:187171387-187171409 GAGAAAGAGAACAAAAATGATGG - Intergenic
985187081 4:187329225-187329247 GAAAAGAATAACAAAAATGATGG + Intergenic
985232034 4:187828870-187828892 GATAATAATAAGAAAACTGCTGG - Intergenic
985237685 4:187894096-187894118 AAGAAAAAAAAGAAAAAGGATGG + Intergenic
985260550 4:188110809-188110831 TAGAAAAATAAGAGAAGTAAAGG - Intergenic
986059777 5:4177097-4177119 GACAGAAATGAGGAAACTGAAGG - Intergenic
986342176 5:6799872-6799894 TAGAAAAATACCCAAACTGAAGG - Intergenic
986439004 5:7762238-7762260 AAGAAAAATCATAAAACTGTAGG + Intronic
986536139 5:8789249-8789271 GAGTAAAATCAGGAAATTGAAGG - Intergenic
986590774 5:9367312-9367334 CAGAACAATAAGAGAACTCATGG - Intronic
986642450 5:9885962-9885984 AAGGATATTAAGAAAACTGAGGG + Intergenic
986651551 5:9968644-9968666 AAAAAAAAAAAGAAAACTGCAGG + Intergenic
986655788 5:10010674-10010696 AGCAAAAATAAGAAAACTGGAGG + Intergenic
986757037 5:10847137-10847159 GAAAAAAAGAACAAAACTGGAGG + Intergenic
986853445 5:11839914-11839936 GAGAAAGATAACTAAACTTATGG + Intronic
986915316 5:12612772-12612794 GAGAAACATAAATAACCTGATGG - Intergenic
987064514 5:14275641-14275663 GAGAAGAAGATGAAAACAGAAGG - Intronic
987632701 5:20495515-20495537 GAGAAAAATAAAAGAACAGTTGG - Intronic
987964153 5:24850677-24850699 GAAAAACATGAGAAAACTGGTGG - Intergenic
988077049 5:26366750-26366772 GAGAAATATAATAAATCTAAAGG - Intergenic
988376592 5:30443279-30443301 GAAAAAAAGAACAAAACTGGAGG + Intergenic
988467924 5:31508790-31508812 GAGAAAAATACAGAAATTGATGG + Intronic
988521847 5:31953080-31953102 AAGAAAAATAAGAATAAAGAGGG + Intronic
988545692 5:32155586-32155608 TAAAAAAATCAGAAAGCTGAGGG - Intronic
988633401 5:32955581-32955603 GAGAATAATAGGAAAGGTGAGGG + Intergenic
989125160 5:38045957-38045979 GAGAGAAATAATGAAAGTGAGGG + Intergenic
989183661 5:38602487-38602509 GAAAAAAAAAAGAAAAGAGAAGG - Intronic
989331330 5:40262365-40262387 GAGAAAACTAAGATAACAGAGGG + Intergenic
989798296 5:45502553-45502575 AAGAAAAAAAGGAAAAATGAAGG - Intronic
990053657 5:51541998-51542020 GACAAAAACAAGAAAAGTAATGG - Intergenic
990074142 5:51821823-51821845 GAGGAAGAAAGGAAAACTGAGGG - Intergenic
990617449 5:57521996-57522018 GAGAAAAATATGATAAGGGAGGG + Intergenic
990756015 5:59071321-59071343 TAGAAAAAAGAGAAAACTGCAGG - Intronic
990820001 5:59828054-59828076 GAGAAAAGTAACAAAACAAATGG + Intronic
991209393 5:64087167-64087189 GTGAAAAAAAAAAAAATTGAGGG + Intergenic
991223452 5:64242474-64242496 GAAACAATTAAAAAAACTGAAGG + Intronic
991518938 5:67472604-67472626 CAGTAAAAGAAGAAAACAGATGG + Intergenic
991545529 5:67778090-67778112 GAGAAAAAGAACAAAACTAGAGG - Intergenic
991702203 5:69326892-69326914 AAGGAAAAAAAGAAAACTGCTGG + Intronic
991991065 5:72339873-72339895 GAGAAAAACAAGCAAAAAGAGGG - Intronic
992166066 5:74053127-74053149 GAGAAAAATATTAGAACTGCAGG + Intergenic
992166674 5:74059280-74059302 CAAAAAAATAAAAATACTGAAGG - Intergenic
992194983 5:74330284-74330306 AAGAAAAAGAAGAAAAATGTAGG - Intergenic
992316154 5:75557268-75557290 TAGAAGAAGAACAAAACTGAAGG - Intronic
992372496 5:76158648-76158670 GAAAACAATAAGAAAATAGAAGG + Intronic
992594614 5:78332906-78332928 GAGAATATAAAGAAAACTGAGGG + Intergenic
992753542 5:79883184-79883206 GAGTAAAAAAAGAAAAATGAAGG + Intergenic
992903771 5:81325056-81325078 CAGAGAAAAAAGAGAACTGATGG + Intergenic
992980372 5:82164635-82164657 GTTAAAAATGAGAAAACTGTGGG + Intronic
993069846 5:83146779-83146801 CAGAAAAATAAGAGAAATAATGG - Intronic
993186377 5:84626960-84626982 GAGAGAGATAAGAAGACTTAAGG + Intergenic
993437630 5:87917038-87917060 CAAAAAAACAAGAAAACTCATGG + Intergenic
993611659 5:90061649-90061671 GAGACCAGGAAGAAAACTGATGG + Intergenic
993806324 5:92415206-92415228 GAGAAAGAAAAGAAAAATTAGGG + Intergenic
993906128 5:93625011-93625033 GAAAAAAATATCATAACTGATGG + Intronic
994062644 5:95497725-95497747 GAGATAATTAAGAAAAGTTAAGG + Intronic
994101882 5:95902755-95902777 GAAAGAAAAAAGAAAATTGATGG - Intronic
994645803 5:102467414-102467436 AAAAAAAATAACAAAACTGGTGG + Intronic
994785391 5:104154910-104154932 AAGAAAAATATCAAAATTGAAGG - Intergenic
994982508 5:106893751-106893773 GATAAAAAGAAGAAAAATGCTGG + Intergenic
995092931 5:108200692-108200714 GAAAAAAAAAAAAAAATTGATGG + Intronic
995120233 5:108528416-108528438 AAGAAAAATAATAAAATTGTGGG - Intergenic
995125861 5:108576542-108576564 GAGAAAAATATGATAAGGGAGGG + Intergenic
995284666 5:110374107-110374129 ATGAAAAATAACAAAACTGGAGG - Intronic
995368547 5:111391563-111391585 GCTAAAATTAAGAAAACTGTAGG + Intronic
995389040 5:111618969-111618991 GAGGAAAAAAAAAATACTGACGG - Intergenic
995455717 5:112349694-112349716 GAGAAAAAGAAAGACACTGAAGG + Intronic
995634747 5:114174477-114174499 AAGAAATACAAGAAAACTTAGGG - Intergenic
995746515 5:115409492-115409514 AAGAAAAACAAGAGAATTGATGG + Intergenic
995767257 5:115632489-115632511 GAGAAAGAAAAGAAAAAGGAAGG + Intronic
995965720 5:117905672-117905694 TAGAAAAATAAGTACATTGAGGG - Intergenic
996188840 5:120513751-120513773 AAAAAAAAAAAGAAAACAGATGG - Intronic
996328551 5:122304582-122304604 GAAAAAAAAAAAAAAGCTGATGG - Intergenic
996328841 5:122307784-122307806 GAGAAAAAAAGAAATACTGAAGG + Intergenic
996360937 5:122645349-122645371 GACAAAAAAAAAAAAACTGCAGG + Intergenic
996506682 5:124275896-124275918 GTAGAAAATAAGGAAACTGATGG + Intergenic
996555183 5:124770914-124770936 AAGAAAACTAAGACAAATGATGG - Intergenic
996566283 5:124882404-124882426 GAGAAAGATAAGTAAACAGAAGG - Intergenic
996632649 5:125653643-125653665 GAGAAAAATAAGAACAAAAATGG + Intergenic
996882525 5:128316168-128316190 CAATATAATAAGAAAACTGAAGG + Intronic
996985152 5:129553025-129553047 CAGGAAAAGAAGAAAACTGGGGG - Intronic
997055408 5:130437755-130437777 AATAAAAATAGCAAAACTGAAGG - Intergenic
997075959 5:130677409-130677431 GAAAACAATAAGAAATCAGAAGG + Intergenic
997101420 5:130973294-130973316 GTGAAAAAGAATAAAACTAATGG - Intergenic
997155652 5:131553760-131553782 GAGTTAAATAAGAAAAATGAAGG + Intronic
997191647 5:131942590-131942612 GAGGAAAAACAGAAAGCTGAGGG + Intronic
997259210 5:132453139-132453161 GAGAAGAAAAAGAAAGCAGAAGG - Intronic
998019742 5:138759467-138759489 GAGGAAAAAGAGAAAAATGAAGG + Intronic
998289957 5:140905472-140905494 AACAAAAAGAAGAAATCTGAAGG - Intronic
998304268 5:141057660-141057682 GGCAAAAATAAGAAAAATGGTGG - Intergenic
998656478 5:144186362-144186384 AAGAAAAAAAAAAAAACTAATGG + Intronic
998726146 5:145017052-145017074 GGAAAAAAGAATAAAACTGATGG - Intergenic
998866743 5:146512517-146512539 AAGAAAAAAAAGGAAACAGAAGG - Intergenic
998888066 5:146715596-146715618 GAGAAAGATACTAAAACTCATGG - Intronic
998964443 5:147524068-147524090 GTCATAATTAAGAAAACTGAGGG + Intergenic
999632497 5:153585271-153585293 GAGAAAGAAAAGAAAAATAAAGG - Intronic
999649097 5:153748188-153748210 GAAAAAAATAAGAGAAAAGATGG + Intronic
1000093032 5:157946757-157946779 GAAAAAAAAAAGAAAATAGATGG - Intergenic
1000132389 5:158312699-158312721 GAAAAAAAAAAAAAAACTGTGGG - Intergenic
1000219602 5:159200273-159200295 GAGGAAATAAAGAAAACTGAAGG + Intronic
1000543878 5:162575045-162575067 CAGAAAAATAAGATACCTAATGG + Intergenic
1000595281 5:163208560-163208582 TAGAAAAATAATCAAACTCAAGG - Intergenic
1000859674 5:166441119-166441141 TTGAAAAATAAGAAAATTGGAGG - Intergenic
1000867229 5:166528712-166528734 AAGAAAAATGAGAAAAATGATGG + Intergenic
1000983750 5:167844890-167844912 GAGAAAGATAGAAATACTGAAGG - Intronic
1001292721 5:170475572-170475594 GATAAAAATAACAAAACAAAAGG + Intronic
1001438234 5:171717855-171717877 AGGAAAAATAAGAATACTGTAGG + Intergenic
1001626138 5:173134748-173134770 GAGAAAAAAAAGAAAAAAAAAGG + Exonic
1001794469 5:174490588-174490610 GAAAAAAAAAAGAAAACATAAGG + Intergenic
1002395928 5:178954367-178954389 GAGAAAAAGAAAAAAACTGAAGG - Intronic
1002657721 5:180765276-180765298 AAGCAAAAGAACAAAACTGAAGG + Intergenic
1002683371 5:180987563-180987585 GGAAAAAAAAAGAAAAGTGAAGG + Intergenic
1002863011 6:1096649-1096671 AAGAAGAAGAAGAAAATTGAGGG - Intergenic
1003282045 6:4702562-4702584 GGGAAAAAGAAGAAAACAAAAGG + Intergenic
1003434750 6:6076711-6076733 AAAAAAAAAAAGAAAACTGTAGG + Intergenic
1003484185 6:6561461-6561483 GACAAAAATAAAAAGAATGAAGG - Intergenic
1003575583 6:7291399-7291421 CAGAAAAATAAAAAAAGTTAAGG + Intronic
1003653649 6:7986081-7986103 GAAAAAAAGAAGGAAACTGACGG + Intronic
1004084828 6:12436399-12436421 GTGAGAGATAACAAAACTGAAGG + Intergenic
1004108388 6:12688493-12688515 GACAGTAATAGGAAAACTGATGG + Intergenic
1004127620 6:12888856-12888878 GGAAAGAATAAGAAAAGTGATGG + Intronic
1004516292 6:16325112-16325134 GACAAAAAAAAAAAAACAGATGG - Intronic
1004529987 6:16445176-16445198 TAGGAAAATATGAATACTGACGG + Intronic
1004623748 6:17355099-17355121 GAAAAAAATCAGAAAATTAATGG + Intergenic
1004678943 6:17873585-17873607 GAGGAAAATAAGAAATTTTATGG - Intronic
1004760532 6:18661087-18661109 GGCAAAAATAACAAAACTGGAGG + Intergenic
1004868956 6:19884024-19884046 GAGAAAAAAAATAATAATGAAGG - Intergenic
1005176677 6:23054469-23054491 GAAGAAAATAAGAAGACAGATGG - Intergenic
1005212642 6:23485774-23485796 GTGACAAATAAGAAAAATTAGGG + Intergenic
1005271361 6:24167400-24167422 GAGAAACATAAGAATCCTAATGG + Intergenic
1005277531 6:24236143-24236165 AAGAAAAAGAACAAACCTGAAGG + Intronic
1005321212 6:24656296-24656318 GAGAAAGTTAAGAAAATTCAAGG + Intronic
1005420716 6:25646643-25646665 GGGAAAAATAAGCATACAGAAGG + Intergenic
1005463487 6:26090456-26090478 AAAAAAAAAAAAAAAACTGAAGG + Intronic
1005795091 6:29351658-29351680 GAACAAAATAAGAAAACTTCTGG - Intergenic
1006096289 6:31658802-31658824 GGAAAAAAAAAAAAAACTGAAGG + Exonic
1006629888 6:35423546-35423568 GAAAAGAAAAAGAAAAGTGAAGG + Intronic
1006880691 6:37336509-37336531 AAGAAAACTAAGAGAACTGTTGG - Intergenic
1006958306 6:37898441-37898463 AAGAATAATAAAAAACCTGAAGG - Intronic
1007205902 6:40150584-40150606 GTAAAGAATAAGAATACTGAAGG - Intergenic
1007530688 6:42539488-42539510 GAGATAAAACAGAGAACTGATGG + Intergenic
1007944930 6:45817640-45817662 GAGAAAAAGAAGACTACTGGGGG - Intergenic
1008091987 6:47303310-47303332 AATAAAAACAAGAAAACTAAGGG - Intronic
1008241630 6:49120064-49120086 GAAAAAAGTATGAAAACCGATGG + Intergenic
1008314018 6:50016773-50016795 GACAAATTTAAGAAAATTGAAGG - Intronic
1008390474 6:50945453-50945475 TTTAGAAATAAGAAAACTGAGGG + Intergenic
1008443106 6:51555526-51555548 ATGAAAAAAAAGAAAACTGCAGG + Intergenic
1008801680 6:55376308-55376330 AACAAAAATAAGAAAACTTCAGG - Intronic
1008879053 6:56362311-56362333 AGCAAAAATAAGAAAACTTAAGG - Intronic
1008882234 6:56393053-56393075 AAAAAAAAAAAGAAAACTGAAGG + Intronic
1009003745 6:57753784-57753806 CAGAAATATAAGAAAACGGCCGG - Intergenic
1009668126 6:66709272-66709294 GAAAAAAAGAAAAAAACTGCTGG - Intergenic
1009712227 6:67339069-67339091 GAAAAAAAGAACAAAACTGAAGG + Intergenic
1009758260 6:67969281-67969303 GAGAAAAATACAGAAACTGAAGG + Intergenic
1009782980 6:68293887-68293909 GAGAAAGAAAAGAAAACTTCAGG - Intergenic
1009849908 6:69182406-69182428 AAGAAAAAAAAAAAAACAGAAGG + Intronic
1009902527 6:69825707-69825729 AATAAAAATAAGAATACGGAAGG + Intergenic
1009917045 6:70009646-70009668 TAAAAAAATAACAAAACTGAAGG + Intronic
1010048816 6:71479570-71479592 GAGAAAAATGAATAAAATGAAGG + Intergenic
1010054426 6:71548255-71548277 GAGTAAAATAATAAAACTGGAGG - Intergenic
1010087092 6:71933322-71933344 GAGAAAGACAAGAAAACACACGG - Intronic
1010113319 6:72269375-72269397 GGGCAAAAGAAGAAAACTGGAGG - Intronic
1010283945 6:74053215-74053237 GAGAAACAGAAGAAAAAAGATGG + Intergenic
1010367516 6:75068670-75068692 CTGAAAAATAACAAAGCTGAAGG - Intergenic
1010481667 6:76362223-76362245 AAGAAAAAAAAGAAAACTTCTGG - Intergenic
1010626583 6:78143678-78143700 AAGAAAAAAAAGAAAACTACAGG + Intergenic
1010733932 6:79420825-79420847 GTGGAAAATAAGAAAATTTAAGG - Intergenic
1010841728 6:80654283-80654305 GAAAAAAAGAAAAAAAATGATGG + Intergenic
1010899729 6:81411389-81411411 GAGAAAATTTAGAAAACATATGG + Intergenic
1011228063 6:85129487-85129509 TAAAAAAATCAGAACACTGAAGG - Intergenic
1011249402 6:85354852-85354874 TAGTAAAATAATAAAAGTGAAGG + Intergenic
1011544672 6:88470147-88470169 TATAAAAATAAGTAAACTGCAGG + Intergenic
1011582983 6:88891922-88891944 AAAAAAAATAAGAAAAATAAGGG + Intronic
1011703291 6:89975460-89975482 GAGAAACAAAAGAAAGCTGAGGG - Intronic
1011730816 6:90261456-90261478 GTGAAAAATAAGAAATGAGATGG - Intronic
1011777667 6:90749827-90749849 GAGGAAAAGAAGAAAAGTGGAGG + Intergenic
1011804619 6:91057997-91058019 AAGAAAAAGAAGAAAAAAGAAGG - Intergenic
1011814411 6:91171732-91171754 GAGAAAAAGAAAAGAACGGAGGG + Intergenic
1011928523 6:92678786-92678808 GTGAAAAATAACAAAGTTGAAGG + Intergenic
1011982425 6:93398589-93398611 GAAAAAAAAAAGAAATCAGATGG + Intronic
1012056752 6:94422208-94422230 GAAAACAATAAGACACCTGAAGG - Intergenic
1012165960 6:95952520-95952542 TAGAAAAAAAAAAAAACTAAAGG + Intergenic
1012321324 6:97850360-97850382 AGGAGAAATAAGAAAACTAATGG + Intergenic
1012340981 6:98122861-98122883 AAGAAAGAAAAGAAAACTGAGGG + Intergenic
1012402661 6:98856326-98856348 GAAAGAAATAGGAAAACTGTAGG - Intergenic
1012435718 6:99213004-99213026 AAGAAAAAGAACAAAGCTGAAGG + Intergenic
1012568544 6:100693343-100693365 AGAAAAAATAACAAAACTGAGGG + Intronic
1012591808 6:100991066-100991088 AAAAAAAAAAAGAAGACTGATGG - Intergenic
1012651269 6:101756184-101756206 TAGAAAATTAATTAAACTGAGGG + Intronic
1012692495 6:102332465-102332487 GAAAAATATAACAAATCTGAAGG - Intergenic
1012705962 6:102530780-102530802 AAGAAAAAAAAGAAAAAAGATGG - Intergenic
1012866765 6:104627263-104627285 GAGAAAAATAAGGGAAAAGAGGG - Intergenic
1012876420 6:104733854-104733876 GAGAAAAAAAAGAAATCAGCCGG + Intronic
1013022535 6:106233772-106233794 GAGAAAAATATGATAAGGGAGGG - Intronic
1013028305 6:106303061-106303083 GAAAAAAATAATAAAACCAAAGG + Intronic
1013134029 6:107262322-107262344 GAGAAAGAATAGAAAACTGGAGG - Intronic
1013301304 6:108807522-108807544 GAGAAAAATTGAAAGACTGAAGG - Intergenic
1013411049 6:109883852-109883874 GAGAACAATATAAAAACTCATGG + Intergenic
1013529982 6:111010108-111010130 AAGAAAAAAAAAAAAATTGAGGG - Intronic
1013540209 6:111100681-111100703 GAGTAAAAAAAGACAACTGTAGG - Intronic
1013577120 6:111494770-111494792 TACAAAAATAAAAAAACTGGTGG - Intergenic
1013594218 6:111646303-111646325 GAAAAAAAAAAGAAAAATGCAGG - Intergenic
1013778543 6:113705130-113705152 GAGAGAATTAAGAAAAATGGAGG + Intergenic
1014023815 6:116620849-116620871 GAAAAGAAAAAGAAAACTCATGG - Intronic
1014195174 6:118548064-118548086 GAAAAAAATAAGTAAACTTGAGG - Intronic
1014327341 6:120015886-120015908 AAGAAAAATGAGAAAACTTATGG + Intergenic
1014629315 6:123770069-123770091 GAGACAAACTAGAAACCTGAAGG - Intergenic
1014678915 6:124403769-124403791 GATAAAAATTAGTAAACTAAAGG - Intronic
1014707677 6:124767575-124767597 GAGAAAAAAAATAGAGCTGAAGG - Intronic
1014717434 6:124882730-124882752 GAGAGAAAAAAGAAAAAGGAAGG + Intergenic
1014808073 6:125853977-125853999 TAGAAAAATGAGATAACTGTAGG - Intronic
1014859756 6:126451354-126451376 GAGAAAAATGATAAACCTGTAGG - Intergenic
1014941453 6:127444894-127444916 AAGAAAGAGAAGAAAAGTGAAGG - Intronic
1015066726 6:129038979-129039001 GAGAAAAATATGGCAAATGAAGG - Intronic
1015077742 6:129181901-129181923 GAGAAAAATATTAAAACTGGGGG + Intronic
1015112919 6:129613686-129613708 GAGATATATAAGAAAACACATGG - Intronic
1015152742 6:130056762-130056784 GAAAAAAATCGGAAAACTTAAGG - Intronic
1015176290 6:130312628-130312650 AAGAAAAAGAAGAAAAGTCAAGG - Intronic
1015181172 6:130364685-130364707 AAGAAAGAAAAGAAAACTAAAGG - Intronic
1015359689 6:132324829-132324851 GAGACAAGAAAGGAAACTGAGGG - Intronic
1015480651 6:133704338-133704360 CAGTAAAAGGAGAAAACTGAAGG - Intergenic
1015718604 6:136217390-136217412 TAGAAAAATAAAAAAACAAAGGG - Intergenic
1015733075 6:136367877-136367899 GAGAAAAAGAAAAAAAAAGAAGG - Intronic
1015781151 6:136867121-136867143 CAGAAAAATTTAAAAACTGATGG - Intronic
1015947556 6:138518434-138518456 AAGAAAAATAATAGAAGTGAGGG + Intronic
1016070009 6:139727311-139727333 GAGAGAAGTGAGAAAATTGATGG - Intergenic
1016082431 6:139872108-139872130 GAGAGAGAGGAGAAAACTGAGGG + Intergenic
1016274228 6:142329789-142329811 GAGAAGAATAAGATATCTTAAGG - Intronic
1016387074 6:143538719-143538741 GACAAGAATAAGAAGACAGAAGG - Intronic
1016398779 6:143655910-143655932 GAGAAAAAGAAGAAAACAGACGG + Intronic
1016445836 6:144131352-144131374 GAGAAAAAAATGAAAAGTAATGG - Intergenic
1016468744 6:144352897-144352919 GAGAAAATTTAGAAAACTACTGG - Intronic
1016499477 6:144703238-144703260 TAGAGAGATAAGAAAACTGCTGG + Intronic
1016954614 6:149614393-149614415 GGGAAAAAAGAGAAAAATGAAGG - Intronic
1016980425 6:149848757-149848779 TAGAAAAAAAACAAAACTGCTGG + Intronic
1017283446 6:152648049-152648071 GAGAAAAAAAATAAAAATAAGGG - Intergenic
1017417894 6:154241494-154241516 GAAAATAATATGAAAATTGAGGG - Intronic
1017454251 6:154586291-154586313 GGGAGAAAAAAGAAAAATGAAGG + Intergenic
1017459629 6:154636859-154636881 AAGAAAAACAAGAAAAATAAAGG - Intergenic
1017462966 6:154668427-154668449 AAGAAGAAGAAGAAAACTGAGGG + Intergenic
1017639685 6:156479950-156479972 AAAAAAAAAAAGAAACCTGAAGG + Intergenic
1017677617 6:156830029-156830051 GAGAAAAAAAAGGAAAATGTTGG - Intronic
1017920879 6:158870807-158870829 GGAAAAAATAAGAAAAATGAAGG - Intronic
1018057577 6:160065699-160065721 TATAAATATCAGAAAACTGAAGG - Intronic
1018194427 6:161342712-161342734 GAGAAAAAAAAAAAAACTGGTGG + Intergenic
1018425327 6:163674821-163674843 GAGAACAATTCAAAAACTGAAGG - Intergenic
1018507427 6:164486388-164486410 AGCAAAAATAACAAAACTGAAGG - Intergenic
1018599104 6:165520004-165520026 GAGAAATAAAAGCAAAGTGAAGG - Intronic
1018661548 6:166091719-166091741 AAGAAAAAGAGGATAACTGAAGG - Intergenic
1018676732 6:166228910-166228932 GAGAAAAGCAAGAAAATTTAAGG + Intergenic
1018879384 6:167861466-167861488 GAGAAAAAAAAGAAACCCAAGGG - Intronic
1019873027 7:3783904-3783926 GAGCAAAAGAATAAAGCTGAAGG + Intronic
1020042038 7:5011599-5011621 GAGTAAAAAAAGAAAAAGGAAGG + Intronic
1020163815 7:5793074-5793096 AAGAAAAAAAAAAAAATTGAGGG + Intergenic
1020389077 7:7640004-7640026 GAGTAAACTAAGAAATCTGAAGG + Intronic
1020525600 7:9254523-9254545 AACAAAAAAAAGAAAACTTAAGG + Intergenic
1020580089 7:9987013-9987035 GAACAAAATTAGAAAACTGTAGG + Intergenic
1020582481 7:10021484-10021506 GAAAAAAATAAGGCTACTGATGG + Intergenic
1020766317 7:12325668-12325690 TAGAAAATTAGGAAAACTGAGGG + Intergenic
1021098614 7:16562421-16562443 GAAAGAAACGAGAAAACTGAAGG - Intronic
1021159270 7:17251565-17251587 GAGAAAAAGAATAAAAGAGAGGG - Intergenic
1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG + Intergenic
1021403490 7:20237312-20237334 AAAAAAAAAAAGAAAACAGAGGG + Intergenic
1021440932 7:20675196-20675218 GAGAAGAAAAACAAAGCTGAAGG + Intronic
1021592443 7:22278331-22278353 GTAAAAAATCAGAAAACTTATGG - Intronic
1021904317 7:25317933-25317955 AATAAAAATAATAATACTGATGG + Intergenic
1022136133 7:27450285-27450307 GAGAAAATCAATGAAACTGAAGG - Intergenic
1022248325 7:28582877-28582899 GGGAAAAACAAGATAACTGATGG + Intronic
1022731282 7:33028703-33028725 TAGAAAAATCAGAAAAAGGATGG + Intronic
1022783917 7:33616585-33616607 GAGAAAAATAGGAAAAAAAATGG + Intergenic
1022853614 7:34293243-34293265 CAGAAAAAATAGAAAACAGAAGG - Intergenic
1023228975 7:38004363-38004385 CAGAAATACAAGAGAACTGAAGG + Intronic
1023268824 7:38437479-38437501 GAGAAATGTATGAAAAGTGAGGG + Intronic
1023471552 7:40527404-40527426 TAGAAAGAGAAGAAAAGTGAAGG - Intronic
1023480291 7:40626667-40626689 GACAATAATGAGAAAACTTATGG + Intronic
1023487845 7:40705912-40705934 AAGGAAATTAAGAAAAGTGAGGG - Intronic
1023590314 7:41774529-41774551 CTTAAAAATAAGAAAACTGTTGG + Intergenic
1023620853 7:42071027-42071049 CAGAAACAAAAGAAAAATGATGG + Intronic
1023810804 7:43910072-43910094 GAGACATATAAGAAAATTGTAGG + Intronic
1024454525 7:49588235-49588257 AAGAAAAATTAGAAAAATGATGG - Intergenic
1024621935 7:51167630-51167652 AGCAAAAATAACAAAACTGAAGG + Intronic
1024703886 7:51936930-51936952 GACAAACAAAAGAAAGCTGAGGG - Intergenic
1024730143 7:52244628-52244650 CAGAAACATGTGAAAACTGAGGG - Intergenic
1025214284 7:57042849-57042871 GAGAGAAAAAAGAAAAGAGAAGG - Intergenic
1025657669 7:63533964-63533986 GAGAGAAAAAAGAAAAGAGAAGG + Intergenic
1025920035 7:65903164-65903186 GAAAAAAAAAAAAAAAATGAAGG - Intronic
1026064871 7:67061714-67061736 AATAAAAATAAGAATACTAATGG + Intronic
1026080745 7:67217685-67217707 GAGAAAAAACACAAAACTGGAGG - Intronic
1026541965 7:71287493-71287515 GAGAGAAATAAGGAGAGTGAAGG - Intronic
1026554799 7:71398273-71398295 GAGAAAAATAAGAAAATTAGAGG - Intronic
1027264877 7:76488893-76488915 GAGAAAAAAAAAAAAAGTGGGGG + Intronic
1027316250 7:76986996-76987018 GAGAAAAAAAAAAAAAGTGGGGG + Intergenic
1027402041 7:77819683-77819705 AACAAAAAGAAGAAAACTGCAGG - Intronic
1027419916 7:78008822-78008844 GGGAAAAAAAAGAAAAAAGAAGG - Intergenic
1027478515 7:78664765-78664787 CAAAAAAATAAGAAAAGGGAAGG + Intronic
1027630785 7:80602726-80602748 AACATAAATAAGAAATCTGAAGG - Intronic
1027801991 7:82765896-82765918 GAGAAAAAAAAGTAAAATGTAGG + Intronic
1027816996 7:82987879-82987901 GGGAAAAATAAGTAAAATGAAGG + Intronic
1028009721 7:85626205-85626227 AAAAAAAAAAAAAAAACTGAGGG - Intergenic
1028118483 7:87029074-87029096 AAGAAAAATAAGGGAGCTGAGGG - Intronic
1028260135 7:88654182-88654204 GAAAAGAATAAGAAAAATGATGG - Intergenic
1028289915 7:89052322-89052344 CAGAAAAATTATAAAACTGATGG - Intronic
1028464495 7:91135187-91135209 GAACAAAAAAAGAAAACTGGGGG + Intronic
1028588018 7:92470355-92470377 GAGAAAAATATGATAAGGGAGGG + Exonic
1028636372 7:92993996-92994018 GAGTAAAAAAAGAACACGGAAGG - Intergenic
1028819801 7:95195274-95195296 GAAAAAAAAAAAAAAACTGATGG - Intronic
1028869347 7:95750526-95750548 AAAAAAAAAAAGAAAAATGATGG - Intergenic
1028938088 7:96488178-96488200 AAGAAAAATCTGAAAAATGAGGG + Intronic
1029018845 7:97342777-97342799 AAAAAAAAAAAGAAAACAGAAGG - Intergenic
1029031328 7:97470490-97470512 GAAATAAAAAAGAAAACAGAAGG + Intergenic
1029102780 7:98147567-98147589 GAGAAAGAAAAGGAAACAGAGGG - Intronic
1029616050 7:101658227-101658249 CACAAAAATAAGAACACAGAAGG - Intergenic
1030122519 7:106123952-106123974 AAGAAAAATAAGAAAGCAGAGGG - Intergenic
1030215143 7:107037077-107037099 GAGAAAAATAAGAAAATTAAAGG - Intergenic
1030238803 7:107296169-107296191 GAGAAAGAAAAGAAAAGAGAGGG - Intronic
1030476466 7:110039896-110039918 GAAAAAAAAAAGAAAACTACAGG - Intergenic
1030549778 7:110943855-110943877 GAGAGAAAAATGAAAACAGATGG + Intronic
1030675102 7:112376132-112376154 GAAAACAGAAAGAAAACTGAAGG - Intergenic
1030765350 7:113402363-113402385 GAGAAAAAAAGGAAAAGAGATGG - Intergenic
1030771979 7:113486250-113486272 AAGATAAATTAGAAAATTGATGG - Intergenic
1030848383 7:114451999-114452021 AAGAAAAATAAGAAAGTTTAAGG - Intronic
1030927196 7:115472957-115472979 GAGAATAAACAGGAAACTGAAGG + Intergenic
1031431309 7:121673408-121673430 GAGAAAAAAAACAAACCTCAAGG - Intergenic
1031435358 7:121726072-121726094 AAGAAAAAAAATATAACTGAAGG - Intergenic
1031469577 7:122153111-122153133 AAGAAAAAGAACAAAACTGGAGG - Intergenic
1031471867 7:122176291-122176313 GAGAAAAATATGACAAGGGAGGG - Intergenic
1031542303 7:123008994-123009016 GAGAAATAAAAAGAAACTGAGGG + Intergenic
1031652450 7:124306989-124307011 TAGAAAAATATAAAAACAGAAGG + Intergenic
1031664887 7:124471845-124471867 GAGACAAATGAGAAAGCTGCCGG + Intergenic
1031899854 7:127396809-127396831 TAAAAAAAAAAGAAAACTTAAGG - Intronic
1032100632 7:128973752-128973774 AAAAAAAAAAAGAAAACAGAGGG + Intronic
1032138255 7:129301799-129301821 GGCAAAAAGAACAAAACTGAAGG - Intronic
1032310764 7:130784622-130784644 GAAAAAAATAAGAAAAAAAATGG - Intergenic
1032579557 7:133091738-133091760 GAAAAAAAAAAAAAAACTAATGG + Intergenic
1032661445 7:133988366-133988388 AAGAAAAATCAGAAAAAAGAAGG - Intronic
1032726157 7:134591733-134591755 GAGAAAAATATGAAAAGGGAGGG - Intergenic
1032761366 7:134946665-134946687 GAGAAAAAAAAAAAAAAGGAAGG - Intronic
1033021663 7:137731303-137731325 GAGACAAATAATAAATCTGTAGG - Intronic
1033119794 7:138657589-138657611 AAGAGCAATTAGAAAACTGATGG - Intronic
1033184158 7:139210577-139210599 GAGGAAAAAAAAAAAACAGAAGG + Intergenic
1033500311 7:141942133-141942155 CAAAAAAATAACAAAACTGGAGG + Intronic
1033554901 7:142480558-142480580 GATAAAAATAAGAAAAGTTTTGG - Intergenic
1033559512 7:142518090-142518112 GATAAAAATAAGAAAAGTTTTGG - Intergenic
1033780480 7:144663360-144663382 GAGAAACATAACCAACCTGATGG - Intronic
1033797834 7:144869146-144869168 GAGAAAAATAAAAAAAAAAAAGG - Intergenic
1033810182 7:145002655-145002677 CAAAAAAATAATAATACTGACGG - Intergenic
1033813853 7:145049196-145049218 GAGCAAAAGAACAAAACTGGAGG - Intergenic
1033835848 7:145310982-145311004 GAGAAAAACAACAAAACTAGAGG + Intergenic
1033881527 7:145889863-145889885 GAGAAAAAGGAGGAAAGTGATGG - Intergenic
1033951899 7:146795317-146795339 GAGAATACTAAGTAAACTCAGGG - Intronic
1034046339 7:147932268-147932290 GAGAAAAAGAACAAAGCTGGAGG + Intronic
1034048557 7:147956974-147956996 GAGAAAAACAAGCAAACAAAAGG - Intronic
1034070495 7:148180057-148180079 GAGAAAAAGAAGAGAAATGTTGG + Intronic
1034220849 7:149445016-149445038 GGAAAGAATAAGAAAACTGAAGG - Intronic
1034525123 7:151654567-151654589 GAGAAAAATGACAAAAAGGAAGG - Intronic
1034694684 7:153043179-153043201 GAGAAAAAAAAGAGAACAGAAGG + Intergenic
1034731664 7:153392440-153392462 GAAAAAAATAAGAAAAAAGAAGG - Intergenic
1034956343 7:155337726-155337748 AAGAAAGAAAAGAAAAATGAGGG - Intergenic
1035115730 7:156522355-156522377 GAAAATAAAAAGCAAACTGATGG - Intergenic
1035985224 8:4422460-4422482 GGTAAAAATAAGAAAAGAGAAGG + Intronic
1036033595 8:4996040-4996062 GAGCAATCTAAGAAAATTGAAGG - Intergenic
1036139049 8:6189619-6189641 GAAAAAAATAAGAAACCTTTTGG + Intergenic
1036175080 8:6529821-6529843 CAGGAAAATAAGAAAACAGATGG - Intronic
1036203325 8:6787103-6787125 AAAGAAAAAAAGAAAACTGAGGG - Intergenic
1036386155 8:8283562-8283584 GACAAAAACAAGGACACTGAGGG + Intergenic
1036389136 8:8309372-8309394 AAAAAAAAAAAAAAAACTGAAGG + Intergenic
1036477548 8:9106885-9106907 GAGAAAAAAAAAAAAACAGAAGG - Intronic
1036535650 8:9648942-9648964 GAGAAAAAAAAAAAAACAGTGGG + Intronic
1036960769 8:13242387-13242409 GAGAAAAAAAAAAAAACTGATGG - Intronic
1037061395 8:14514034-14514056 GAGCATAATAAGAACACTGTAGG + Intronic
1037188223 8:16090539-16090561 GATAAAAATATTAAAACTAAGGG - Intergenic
1037535843 8:19823506-19823528 GAGAATAATCAGAACATTGAGGG - Intronic
1037629426 8:20640051-20640073 GATGAAACTAAGAAAATTGAAGG - Intergenic
1037864729 8:22434494-22434516 AAAAAAAAGAAGGAAACTGAGGG + Intergenic
1038137132 8:24798968-24798990 GAGAAAAATAAAAACACATAGGG + Intergenic
1038214250 8:25547104-25547126 GAGAAAAATTAGCATAGTGATGG + Intergenic
1038852861 8:31297100-31297122 GATAAAGAAAAGAAATCTGAGGG + Intergenic
1039172902 8:34768905-34768927 GAGAAAGATAAGAAAAGAAAAGG + Intergenic
1039192339 8:34990909-34990931 GAGAAAAGTAAGAAAGCTGCAGG + Intergenic
1040086115 8:43344322-43344344 TTAAAAAAGAAGAAAACTGAAGG - Intergenic
1040280313 8:46038108-46038130 GAAAGAAAAAAGAAAAATGAAGG + Intergenic
1040449124 8:47526392-47526414 GAGAGAAATCAGAAAATTTAAGG + Intronic
1040624676 8:49133468-49133490 GAGTTAAATAAGAAACATGAAGG + Intergenic
1040640246 8:49325260-49325282 GAGAAAATCAACAAAGCTGAAGG + Intergenic
1040689694 8:49921209-49921231 GAAAAAAATAAGAGAAAAGAAGG + Intronic
1040933316 8:52757448-52757470 AACAAAAATAATAAAGCTGAAGG + Intergenic
1041018959 8:53618903-53618925 GAGGGAAAAAAGAAAACTGCTGG + Intergenic
1041192613 8:55368655-55368677 GAGAATAATAATAAAACATAGGG - Intronic
1041307821 8:56481518-56481540 GAAAAAAAGAAGAAAAAGGAAGG + Intergenic
1041427122 8:57734589-57734611 AACAAAAAGAACAAAACTGAAGG - Intergenic
1041472012 8:58221074-58221096 GAGAATAAAAAGAAAAATGATGG - Intergenic
1041580386 8:59452152-59452174 AAGAAAAAAAACTAAACTGATGG - Intergenic
1041648241 8:60275675-60275697 AAGAAATATAAGAAAATTGCTGG + Intronic
1041718668 8:60956211-60956233 GAAAAAAAAAAAAAAACTGTTGG - Intergenic
1041795219 8:61739684-61739706 GAGAAAAACAAAAAAAGTAAGGG + Intergenic
1041814318 8:61950764-61950786 AAAAAAAAAAAAAAAACTGAAGG + Intergenic
1042249830 8:66744860-66744882 AAAAAAACTAAGAAAATTGAAGG - Intronic
1042440988 8:68826327-68826349 GAGAAAGATAAGGAAGCTGCAGG - Intergenic
1042505308 8:69553175-69553197 GAGAAAAAGCAGAAAGCAGATGG + Intronic
1042581421 8:70283200-70283222 GGCAAAAATCAGAAAACTAATGG + Intronic
1043023650 8:75038765-75038787 GTGAAAGATAAGACAATTGATGG - Intergenic
1043037662 8:75218704-75218726 GAAAAAAATAGAAAAAATGAGGG + Intergenic
1043055957 8:75438902-75438924 GAGAAAAAAAATCAAAGTGAAGG - Intronic
1043219414 8:77640526-77640548 GGGTAGAATAAGAGAACTGAAGG + Intergenic
1043274697 8:78378507-78378529 TAGAAAATAAAGAAAACTGCAGG - Intergenic
1043285173 8:78518852-78518874 GAGGAAGATAATCAAACTGAAGG + Intronic
1043424784 8:80137931-80137953 GAAAAAAAAAAGAAAAGAGACGG - Intronic
1043793123 8:84499080-84499102 AAAAAAAAAAAGAAAACAGATGG - Intronic
1043812798 8:84763210-84763232 GAGAGAAATGAGAAAAGTGAAGG + Intronic
1043948599 8:86282386-86282408 GAGAAGACTAAGAACCCTGAAGG - Intronic
1043979549 8:86622303-86622325 GAGAAAAATAAATAAATTCAAGG - Intronic
1044099758 8:88120180-88120202 AAGAAAAAAAAGAAAACAGAAGG + Intronic
1044185606 8:89247318-89247340 GAGCAAAAGAACAAAACTGGAGG - Intergenic
1044227286 8:89733923-89733945 GAAAAAAATAAGAAAGATCAGGG + Intergenic
1044357296 8:91237853-91237875 GAGAAAACAAAGAAAGATGAGGG - Intronic
1044592671 8:93929441-93929463 GGGAAAAACAAGAAAAGTGAGGG + Intergenic
1044656090 8:94550098-94550120 AAAAAAAAAAAAAAAACTGATGG + Intronic
1044691041 8:94878741-94878763 GAGAAAAGTAAGAGCAGTGATGG - Intronic
1044796242 8:95901288-95901310 GAAAAAAGAAAGAAATCTGAAGG + Intergenic
1044930023 8:97243496-97243518 AAGAAAAAGAAAAAAACTGTTGG - Intergenic
1045047386 8:98292923-98292945 TATAAAAATAGGAAAAATGAGGG - Intronic
1045456381 8:102383661-102383683 GAGAAAAATGATAAAATGGATGG + Intronic
1045457704 8:102398026-102398048 GAGCAAAATAACAAAATTGGAGG + Intronic
1045462103 8:102434243-102434265 GAGAAAAAAAAAAAAAAAGAAGG + Intergenic
1045602086 8:103729025-103729047 GTGAAAAACAAAAAAACTAAAGG - Intronic
1045698982 8:104844160-104844182 CAGCAAAAAAAGAAAACTGCAGG - Intronic
1045726644 8:105181505-105181527 GAAAAAAAAAAAAAAACAGAAGG - Intronic
1046147516 8:110180574-110180596 GCAAAAAATAACAAAACTGGAGG - Intergenic
1046383109 8:113475414-113475436 GAGAAAAATAACAAAACACTTGG - Intergenic
1046544890 8:115637398-115637420 TAGAAAATGAAGAAAAGTGATGG + Intronic
1046782422 8:118230002-118230024 ATTAAAAAAAAGAAAACTGAGGG + Intronic
1047054901 8:121153077-121153099 GAGAGAAGAAAGAAAACTGGAGG - Intergenic
1047230578 8:122994956-122994978 GAGAAAACTGGGAAAACAGAGGG + Intergenic
1047277762 8:123418515-123418537 GAGAAAAATAAGATAAAGGATGG + Intronic
1047351159 8:124075879-124075901 CAGAAAAATGAGAAAAATGCCGG - Intronic
1047962781 8:130023149-130023171 AAGAAAAGAAAGAAAACAGAGGG + Intergenic
1048236665 8:132697642-132697664 AATAAAAATAAAGAAACTGATGG + Intronic
1048400309 8:134060789-134060811 GGAAAAAATAACAAAACTGTGGG + Intergenic
1048755822 8:137737157-137737179 CAAACAAATAAGGAAACTGAAGG - Intergenic
1048811892 8:138295878-138295900 GAAATAAATAAAAAAATTGAGGG + Intronic
1049130248 8:140833175-140833197 TAAAAAAAAAAGAAACCTGAAGG + Intronic
1049817873 8:144616387-144616409 GAGAGAAATGAGAAAACCCATGG + Intergenic
1050004569 9:1116647-1116669 AAGAAAATGAAGAAAAATGAAGG - Intergenic
1050155294 9:2660639-2660661 GAGAAAAATAAGTAAATCGAAGG + Intergenic
1050181758 9:2930659-2930681 GAAAAAAATAAGACAAGTGTTGG - Intergenic
1050221216 9:3392525-3392547 GAAAAAAACAAGAAAACAGAGGG + Intronic
1050298802 9:4235301-4235323 AAAAAAAAAAAAAAAACTGATGG + Intronic
1050356606 9:4789622-4789644 AAGAAAAAGAACAAAACTGGAGG + Intergenic
1050668089 9:7964226-7964248 GGGAAAAATGAGAAAAATGGGGG + Intergenic
1050685302 9:8162123-8162145 AAGAAAAAAAAGAAATCTAATGG - Intergenic
1050830860 9:10010474-10010496 GTGAAAAATGAGGAAAATGAGGG + Intronic
1050912863 9:11095978-11096000 GTGAAAAATATGCATACTGAGGG - Intergenic
1050957440 9:11682421-11682443 AAGAAAAAAAGGAAGACTGAGGG + Intergenic
1050965905 9:11802514-11802536 AATAAAAAGAACAAAACTGAAGG - Intergenic
1051012292 9:12432042-12432064 GAGCAAAAGAATAAAACTTAAGG - Intergenic
1051033415 9:12712410-12712432 GAGAAAATTCAGAAAATTAAGGG + Intergenic
1051149503 9:14065097-14065119 GAAAAAAAAAAAAAAACTGAAGG - Intergenic
1051352405 9:16210128-16210150 TTGAAAAAGAAGAAAGCTGAAGG - Intronic
1051513216 9:17903185-17903207 GAGAAATATAGGAAGACTGAGGG + Intergenic
1051575155 9:18606766-18606788 GCAATAAATAAGAAAACTGGGGG - Intronic
1051591598 9:18781314-18781336 CAGAAAAATAAAAAATGTGATGG - Intronic
1051773739 9:20610992-20611014 CAGAGAAATAAGTAAAATGAAGG + Intronic
1051900855 9:22037922-22037944 GAGAATAATAATAAAAGTTAGGG + Intergenic
1052009613 9:23390239-23390261 GAGAAAAAAAAAAAAAAAGATGG + Intergenic
1052054223 9:23885156-23885178 GAGAAAAATAAAACAACAGCTGG - Intergenic
1052060614 9:23956210-23956232 AAGAAAAATAAAAAAACTAAAGG - Intergenic
1052065898 9:24019254-24019276 AAGAAAACTAATAAAATTGAAGG - Intergenic
1052077649 9:24163099-24163121 CAGAAAAGAAAGAAAAATGATGG - Intergenic
1052197353 9:25733498-25733520 GAAAAAAAAAAGGAAACTCATGG + Intergenic
1052208038 9:25867337-25867359 AAGAAAAATAAGCAAACAGAAGG + Intergenic
1052210465 9:25896869-25896891 GAGAAAAATAGAGAAACTGAAGG - Intergenic
1052383396 9:27796271-27796293 AAGAAAAAGAACAAAGCTGAAGG - Intergenic
1052396122 9:27940465-27940487 GAGAAAAGTGAGAAACCTGAGGG - Intergenic
1052434239 9:28405984-28406006 GAGAAAAATTAGAAAGCTATTGG - Intronic
1052525440 9:29612601-29612623 GAGAAAAAAAAAAAACCTGGAGG + Intergenic
1052546789 9:29889903-29889925 GAGGAAAATAAACAACCTGAGGG + Intergenic
1052631422 9:31046147-31046169 GAGATTCATAAGAAAACTGAAGG + Intergenic
1052673838 9:31593916-31593938 GAAAAAAAAAAGAAATGTGAGGG - Intergenic
1052978116 9:34426944-34426966 GAGAAAAAAAAAAAAAGTGCTGG - Intronic
1053330388 9:37200675-37200697 GAGTCAAATAAGAAATTTGAGGG + Intronic
1053355756 9:37444155-37444177 GAGAAAAGGAAGAATACAGAGGG + Intronic
1053382422 9:37659924-37659946 AAAAAAAAAAACAAAACTGAGGG + Intronic
1053520593 9:38773898-38773920 AACAAAAAGAAGAAAACTGGAGG - Intergenic
1053554945 9:39126748-39126770 TATTAATATAAGAAAACTGATGG + Intronic
1053559380 9:39174372-39174394 GAGAAAAAAAAAAAAAAAGATGG - Intronic
1053583547 9:39432318-39432340 GAGGAGAATAATAAAAATGAGGG - Intergenic
1053753906 9:41283690-41283712 GAGAAAAATAAGAACAGTAAGGG + Intergenic
1053819063 9:41947004-41947026 TATTAATATAAGAAAACTGATGG + Intronic
1053847742 9:42257171-42257193 GAGGAGAATAATAAAAATGAGGG - Intergenic
1054105127 9:60991061-60991083 GAGGAGAATAATAAAAATGAGGG - Intergenic
1054109329 9:61090656-61090678 TATTAATATAAGAAAACTGATGG + Intergenic
1054259426 9:62848051-62848073 GAGAAAAATAAGAACAGTAAGGG + Intergenic
1054332350 9:63771986-63772008 GAGAAAAATAAGAACAGTAAGGG - Intergenic
1054611528 9:67240469-67240491 TATTAATATAAGAAAACTGATGG - Intergenic
1054730739 9:68700517-68700539 AAGAACAATAAGAAAACTGGAGG - Intergenic
1054823792 9:69550241-69550263 GATAAAAATAATAAACTTGATGG + Intronic
1054945462 9:70791729-70791751 GATAAAAAATTGAAAACTGATGG + Intronic
1054991608 9:71333927-71333949 GAGGAAAATAACACATCTGAAGG + Intronic
1055222659 9:73955805-73955827 AACAAAAAAAAGAAAACTGCAGG + Intergenic
1055288873 9:74761709-74761731 AAGAAAAAGAAGAATACTCAAGG - Exonic
1055326425 9:75135548-75135570 GGAAAAATTAAGAAAACTGAAGG - Intronic
1055418866 9:76114591-76114613 GAGAAAACTAAGAAACATGTTGG + Intronic
1055499471 9:76888797-76888819 GAGAAGTAGAAGAGAACTGAAGG - Intronic
1055504888 9:76937944-76937966 AAAAAAAAAAAAAAAACTGATGG + Intergenic
1055507650 9:76964593-76964615 AAGAAAGGTAAGAAAACTCAGGG + Intergenic
1055804762 9:80080153-80080175 GGGAAAGAGAATAAAACTGAAGG + Intergenic
1056014432 9:82368326-82368348 GATAAAGAGAAGAAAACAGAAGG - Intergenic
1056116999 9:83450341-83450363 AAAAAAAAAAAAAAAACTGAGGG - Intronic
1057053061 9:91940438-91940460 AAGAAAAATCAGAAAACTTGGGG + Intronic
1057376168 9:94525239-94525261 AAGAAATATAAGAAGACTGAAGG - Intergenic
1057459024 9:95242649-95242671 GAGAAAAATAAAAAAAGAGAAGG + Intronic
1057894749 9:98900093-98900115 AAAAAAAATAAGAAAATTGATGG - Intergenic
1058334464 9:103808262-103808284 GAGATAAATAGGAATCCTGAAGG - Intergenic
1058443969 9:105037341-105037363 CAGAAAAAGAAGGAAAGTGAGGG + Intergenic
1058522392 9:105823739-105823761 AACAAAAAGAACAAAACTGATGG - Intergenic
1058622283 9:106896199-106896221 GAGAAAAACAAAAACAATGAGGG - Intronic
1058767812 9:108198822-108198844 GAGAAAAACAGGAAAAGTAAAGG + Intergenic
1058930926 9:109718047-109718069 ACGAAAAATAAGGTAACTGAAGG - Intronic
1058999950 9:110338002-110338024 GCCAAGAATCAGAAAACTGAGGG + Intergenic
1059011231 9:110463567-110463589 GAGAAAATAAAGAAAAAGGAAGG + Intronic
1059076444 9:111198185-111198207 GAGAAACATAACCAACCTGACGG + Intergenic
1059095101 9:111404559-111404581 GAGAAAAATAACAAAGCGGGAGG - Intronic
1059154854 9:111980640-111980662 GAGAGAGATAAGAAAACCAAGGG - Intergenic
1059227079 9:112682112-112682134 GAGATACAGAAGAAAACTGGAGG + Intergenic
1059241259 9:112807832-112807854 GATAGAAATAAGAACACAGAGGG - Intronic
1059380989 9:113924498-113924520 GAGAAAATTAATGAAACTAATGG - Intronic
1059482830 9:114605190-114605212 GAGAAAAATAATTAAACAGGTGG - Intergenic
1059664031 9:116428790-116428812 GGGTAAGGTAAGAAAACTGAGGG - Intronic
1059868266 9:118541692-118541714 GAGAAAGAAAAGAAAAATGAAGG - Intergenic
1059872553 9:118594113-118594135 GAGAAAAATGAAACAACAGAAGG - Intergenic
1059906213 9:118989819-118989841 CAGAACAAAAAGAAGACTGATGG + Intergenic
1059933454 9:119284092-119284114 GAGAGAAATAAGAGGACTGGTGG - Intronic
1060064272 9:120489498-120489520 GAGAAAATTAAGAAAACTAGAGG - Intronic
1060141696 9:121215985-121216007 TAAATAAATAAGAAAAGTGATGG - Intronic
1060458594 9:123825932-123825954 CAGCAGAAAAAGAAAACTGATGG - Intronic
1060539972 9:124422759-124422781 AAAAAAAAAAAAAAAACTGATGG - Intergenic
1061240224 9:129365899-129365921 AAAAAAAAAAAGAAAACCGAAGG + Intergenic
1061389449 9:130309537-130309559 AGGAAAAAAAAGAAAAATGATGG + Intronic
1061992242 9:134165819-134165841 GAGGAAATTAAGGAAACTTAAGG - Intergenic
1062060697 9:134493776-134493798 GAAAAAGAGAAGAAAACTGCAGG - Intergenic
1062657231 9:137610386-137610408 GAAAAAAAAAAGAAAAATGCTGG - Intronic
1203633054 Un_KI270750v1:87297-87319 GAGAACACAAAGAAAACTCAAGG - Intergenic
1186254655 X:7705264-7705286 GAGAAATAAAAGAAATCTGTAGG + Intergenic
1186404665 X:9291369-9291391 AATAAATATAAGAAAACTTAAGG + Intergenic
1186431077 X:9504596-9504618 GAGGAACATAAGCAACCTGATGG + Intronic
1186535740 X:10346077-10346099 GAGAAAGATAAGAAAATGGCTGG - Intergenic
1186536480 X:10355465-10355487 GCAATAAATAAGAAAAATGAAGG + Intergenic
1186869615 X:13757595-13757617 AAGTTAAATAAGAAAACTTAAGG + Intronic
1186913260 X:14192652-14192674 GAGGAACATAAATAAACTGATGG - Intergenic
1186964142 X:14769576-14769598 GAAAAAATTAATAAAACAGATGG - Intergenic
1186988422 X:15041081-15041103 GAGAAAAAAGAGAAAAAGGATGG - Intergenic
1187016893 X:15338094-15338116 GAGAAATATAAGAAAAATATTGG + Intergenic
1187105952 X:16241976-16241998 GTGAAAAAAAGGAAAACTAATGG - Intergenic
1187111027 X:16300475-16300497 GATAAAAATAAGATTCCTGAGGG + Intergenic
1187438900 X:19299393-19299415 GAGAAAAATAAATAAACTTTAGG - Intergenic
1187564950 X:20440153-20440175 AAAAAAAAAAAAAAAACTGAAGG - Intergenic
1187570598 X:20496835-20496857 GAGAAAAATAAGAAGTCTAGAGG + Intergenic
1187856385 X:23639831-23639853 GAGAGAAAAAAAAAAACTGTAGG + Intergenic
1187867966 X:23741356-23741378 AAAAAAAAAAAGAAAACTCAAGG + Intronic
1187959404 X:24554317-24554339 AAGAAAAACAAAAAAACAGAGGG + Intergenic
1188205210 X:27347456-27347478 GAGAAATATAAAAATGCTGAAGG + Intergenic
1188265622 X:28069835-28069857 GAAAAAAAAAACAAAACTGGAGG - Intergenic
1188275368 X:28193708-28193730 GGCAAAAATAACAAAACTGGAGG - Intergenic
1188333983 X:28905794-28905816 TAGAAAAATAAAAACACAGAAGG + Intronic
1188487004 X:30692936-30692958 GTGATAAATAAGAATACAGATGG + Intronic
1188605741 X:32027309-32027331 GAGAAAAATGAGTTAACAGAAGG - Intronic
1188619710 X:32205355-32205377 GAGAAAAAGTTGAAAAGTGATGG - Intronic
1188812432 X:34667358-34667380 GTAAAAAATAAGAAGACTGAAGG - Intergenic
1188866844 X:35323614-35323636 GAGCAAAAAAACAAAACTGGAGG + Intergenic
1188895740 X:35666100-35666122 GAGAAGACCAATAAAACTGAGGG + Intergenic
1188983312 X:36748142-36748164 GAAAAAAAAAAGAAAACTTTAGG - Intergenic
1189455592 X:41186105-41186127 GAAAAAAAAAAGAAAAATTAAGG - Intronic
1189571004 X:42296958-42296980 AAGACAAAAAACAAAACTGAGGG + Intergenic
1189630778 X:42950704-42950726 AATTAAAAAAAGAAAACTGATGG - Intergenic
1189793886 X:44628951-44628973 GAAAAAAAAAAGAAAAATGAAGG + Intergenic
1189844674 X:45123540-45123562 AAGAAAAAGAACAAAACTGAAGG - Intergenic
1189853873 X:45202944-45202966 GAGAAACAAAAGAAAACCAAAGG + Intergenic
1190042825 X:47085216-47085238 GAGAAAAATAAGAATAGTACAGG + Intronic
1190476673 X:50834889-50834911 GAGAAAAATAAGACAAGGTATGG - Intergenic
1190801405 X:53792833-53792855 AAGAAAGAAAAGAAAACTGCAGG - Intergenic
1190819283 X:53958479-53958501 AAGATAAATGAAAAAACTGATGG + Intronic
1190960014 X:55236684-55236706 AAGAAAAAGAACAAAACTGGAGG - Intronic
1190993304 X:55576482-55576504 CAAAAAAATTAGAAAATTGAAGG + Intergenic
1191051003 X:56192520-56192542 ACGAAAAACAACAAAACTGAAGG + Intergenic
1191054830 X:56231350-56231372 TAAAAAAATAAGGAAACGGAAGG - Intergenic
1191059006 X:56274941-56274963 AGCAAAAATAATAAAACTGAAGG - Intronic
1191083854 X:56543800-56543822 GAAAAAAAGAACAAAACTGGAGG + Intergenic
1191162958 X:57353499-57353521 AAGAAAAAAAAGAAAACCAAGGG + Intronic
1191222717 X:58007012-58007034 GAAAAAAAAAAAAAAACTGAAGG + Intergenic
1191225058 X:58034196-58034218 GAGAAACATAAATGAACTGATGG - Intergenic
1191607672 X:63079921-63079943 GAAAAAAGTAAGAAAACTACAGG + Intergenic
1191655536 X:63593801-63593823 GAAAAGAATAAGAAACCTGGAGG + Intergenic
1191694283 X:63973276-63973298 GAAAAAAAAAAAAAAGCTGAAGG + Intergenic
1191919712 X:66242071-66242093 CAGAAAAAAAAAAAAACTGAAGG + Intronic
1191943730 X:66506444-66506466 GACAAAAAAAAAAAAACTTATGG + Intergenic
1191966592 X:66765941-66765963 GAGAAACATAAACGAACTGATGG - Intergenic
1192026490 X:67457741-67457763 GAGGAACATAAATAAACTGATGG + Intergenic
1192404713 X:70873039-70873061 AAAAAAAATCATAAAACTGAGGG + Intronic
1192543692 X:71995708-71995730 GAGAAAAATGAAACAACGGAGGG - Intergenic
1192613330 X:72590127-72590149 AAGAAAAAGAAGAAAGCTGGAGG + Intronic
1192747786 X:73956810-73956832 AAGAAAAAAAAGAAAACTATTGG - Intergenic
1192786383 X:74340176-74340198 GAGGAAAAAGAGAAAAATGAAGG + Intergenic
1192970486 X:76223386-76223408 GATAAAAATAATTAAAATGAGGG - Intergenic
1193079493 X:77391506-77391528 GAAAAAAATAAAAGACCTGATGG + Intergenic
1193167375 X:78296336-78296358 AAGCAAAATAAGAAAACTGGAGG - Intronic
1193237026 X:79119937-79119959 CAGCAAAAAAAGAAAACTAAGGG - Intergenic
1193239453 X:79149815-79149837 AAAAAAAAAAAAAAAACTGAGGG - Intergenic
1193265344 X:79462782-79462804 GAACTGAATAAGAAAACTGAAGG + Intergenic
1193440302 X:81532675-81532697 GAGAATAAAAAAAAAACTAATGG + Intergenic
1193523803 X:82563879-82563901 GAGAAGAAAAAAAAAACTTATGG + Intergenic
1193594355 X:83428039-83428061 AAGAAAAAGAACAAAACTGGAGG + Intergenic
1193642988 X:84034563-84034585 GAGAAAAATATTAAAAGTAAAGG + Intergenic
1193656564 X:84205531-84205553 AAGAAATTTAAGAGAACTGAAGG - Intergenic
1193670644 X:84381399-84381421 GGCAAAAATAACAAAACTGGAGG + Intronic
1193683261 X:84547831-84547853 AAGAAAAAGAACAAAACTGGAGG - Intergenic
1193785128 X:85751657-85751679 GAGAAAATAAATAAAATTGATGG - Intergenic
1193898351 X:87142801-87142823 GATAAAAATGAGAAAAATAAGGG - Intergenic
1193961652 X:87932926-87932948 GAGGAAAAGAAGAAAAGTGGAGG - Intergenic
1194016974 X:88634883-88634905 AAGCAAAAGAACAAAACTGAAGG + Intergenic
1194024100 X:88730048-88730070 AAGAAGAAGAAGAAAACTAAAGG + Intergenic
1194225228 X:91248212-91248234 GAGCAAAACAACAAAACTGGAGG - Intergenic
1194267511 X:91773446-91773468 CAGAAAAATAAGAATACAGTAGG + Intergenic
1194299462 X:92167713-92167735 TAGAAAAAGAAGAAAATTCATGG - Intronic
1194385589 X:93249861-93249883 AAGAAAATTAAGAAAGCAGAAGG - Intergenic
1194498366 X:94647484-94647506 AGGAAAAATATGAAAACTAAAGG - Intergenic
1194542071 X:95186436-95186458 GAGAAAAAGAACAAAACTGGAGG - Intergenic
1194834562 X:98665827-98665849 AACAAAAAGAATAAAACTGAAGG - Intergenic
1194841024 X:98742271-98742293 TAAAGAAATAAGAAAACTCAAGG - Intergenic
1194859451 X:98978881-98978903 GAAAAAAAAAAGAAAAATGAAGG + Intergenic
1194895113 X:99431247-99431269 AAGAAAAAATAGAAAATTGATGG + Intergenic
1194946676 X:100076483-100076505 GTAAAGAATAAGAAAACTGTGGG - Intergenic
1194999108 X:100624765-100624787 AAGAAAAAAAAAGAAACTGAAGG + Intergenic
1195209506 X:102639473-102639495 GAGAGAAAGAAGAAAATTGCTGG + Intergenic
1195286271 X:103387524-103387546 AAGAAAAAAAAGAAAAATGCTGG - Intergenic
1195630894 X:107054108-107054130 GAGAAAAATATGATAAGGGAGGG + Intergenic
1195641972 X:107185345-107185367 AACATAATTAAGAAAACTGAAGG - Intronic
1195714382 X:107804362-107804384 AAGAGAAAGAAGATAACTGAAGG + Intergenic
1195835058 X:109104495-109104517 GAAAAAAATTAGAAAACATATGG - Intergenic
1196142455 X:112279059-112279081 AAAAACAATAAGAAAACTGAAGG + Intergenic
1196257226 X:113535026-113535048 TAGAAAAATAAGAAAAATTATGG + Intergenic
1196491189 X:116269299-116269321 GAGAAATAAAAGATAATTGACGG - Intergenic
1196499935 X:116368354-116368376 GAAAAAAAAAAGAAAATTGCTGG + Intergenic
1196517888 X:116634583-116634605 AGGAAAAATAACAAAACTGGAGG + Intergenic
1196626499 X:117883144-117883166 GAGCAAAATAAAAAAACTGGAGG + Intergenic
1196752117 X:119127355-119127377 GAGAAAAATATGAAAGATGAGGG + Intronic
1196871942 X:120120808-120120830 GAGAAAGATCAGAACACTGGAGG - Intergenic
1197072679 X:122319305-122319327 GAGAAAAAAAAGAAAGCTGGAGG - Intergenic
1197101185 X:122657230-122657252 GAAAAAAAAAACAAAACTGGAGG + Intergenic
1197142087 X:123129201-123129223 GAAAAAAAAAAGAAAACTTCAGG + Intergenic
1197205881 X:123790155-123790177 GAAAGAAAGAAGAAAAATGAGGG + Intergenic
1197347872 X:125346226-125346248 AAAAAAAAAAAGAAAAGTGAAGG - Intergenic
1197409683 X:126099924-126099946 GAGAAAAGAAAGAAAAATGTTGG - Intergenic
1197568082 X:128113537-128113559 AAGAAAAATAACATAACCGAAGG + Intergenic
1197581595 X:128290655-128290677 AAGAAAAAAGACAAAACTGATGG + Intergenic
1197684431 X:129424254-129424276 AACAAAAATAACAAAACTGGAGG - Intergenic
1198439156 X:136645138-136645160 GGGAAAAATAAGAAAAACAATGG - Intergenic
1198496437 X:137197983-137198005 AAGAAAAAAAAGAAATCTCAAGG + Intergenic
1198763577 X:140058776-140058798 AAAAAAAAAAAGAAAAGTGAAGG + Intergenic
1198764792 X:140069552-140069574 GAGAGCAATAAGGAAAATGAAGG + Intergenic
1198872104 X:141186969-141186991 GAGCAAAAGAAGAAAACTGCAGG - Intergenic
1199032502 X:143016683-143016705 AAGAAAAATAATAAAATGGAAGG + Intergenic
1199044797 X:143156456-143156478 AATAAAAATAGAAAAACTGAAGG + Intergenic
1199227081 X:145389641-145389663 AAGAAAAAGAACAAAACTGGAGG - Intergenic
1199339932 X:146665708-146665730 GAAAAAAGAAAGAAAACTGTAGG + Intergenic
1199391758 X:147288209-147288231 GAGAAAAAGAAGACAACTCTTGG - Intergenic
1199549743 X:149045861-149045883 GAAAAAAATAAGTAAATGGATGG - Intergenic
1199592406 X:149479356-149479378 AACAAAAATAAGCAACCTGATGG - Intergenic
1199619160 X:149683977-149683999 GAGACAAAAAAGAATACTGCAGG + Intergenic
1199827415 X:151514435-151514457 GAGAAAGAAAAGAAAAGAGAGGG - Intergenic
1199922279 X:152419807-152419829 GACAGAAAAAAGAAAACTGACGG + Intronic
1200273044 X:154705172-154705194 AAGAAAAAAAAGAAAACTACAGG + Intronic
1200328827 X:155272797-155272819 GAGAAAAAGAACAAAACTGGAGG - Intergenic
1200561695 Y:4711517-4711539 GAGCAAAACAACAAAACTGGAGG - Intergenic
1200617109 Y:5392842-5392864 TAGAAAAAGAAGAAAATTCATGG - Intronic
1200641488 Y:5723617-5723639 GAAAATAAAAAGAAAAATGACGG + Intronic
1201336217 Y:12882884-12882906 CGGAAAAAGAACAAAACTGAAGG - Intergenic
1201379717 Y:13361481-13361503 GGGAAAAATAATCAAACTTAAGG + Intronic
1201408916 Y:13678527-13678549 AAGCAAAATAACAAATCTGAAGG + Intergenic
1201417563 Y:13762495-13762517 TAGAAAAATGAAAATACTGATGG - Intergenic
1201850674 Y:18476530-18476552 GAGAAAAGGAAGGAAACTCAAGG - Intergenic
1201882644 Y:18843847-18843869 GAGAAAAGGAAGGAAACTCAAGG + Intergenic
1201971329 Y:19799898-19799920 GAACAAAATAACAAAACTGGAGG + Intergenic
1202588923 Y:26461956-26461978 GAAAAAAAGAAGAGAAATGAGGG - Intergenic