ID: 958806714

View in Genome Browser
Species Human (GRCh38)
Location 3:98819774-98819796
Sequence AAGGAGGACTGGATTGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958806714 Original CRISPR AAGGAGGACTGGATTGAAGT TGG (reversed) Intronic
900333404 1:2148501-2148523 ATGGAGGCCTGGATAGAAGACGG - Intronic
900777395 1:4595160-4595182 AAGGAGGCCTGGCTTGCAGCAGG + Intergenic
901502802 1:9663996-9664018 AACGAGGGGTGCATTGAAGTCGG - Intronic
902292657 1:15445517-15445539 AAGCAGGACTGGGTTGGGGTGGG - Intronic
905281491 1:36852305-36852327 AAGGAGGACAGCATTGAGCTAGG + Intronic
906694220 1:47813317-47813339 AAGGAGGACCGGATTGGAGGGGG + Intronic
907613348 1:55895631-55895653 AAGTGGGACTGGATTGAGGAAGG - Intergenic
907662877 1:56409390-56409412 AACGGGAACTGGATTGAGGTGGG - Intergenic
909274855 1:73670457-73670479 AAAGATCACTGGCTTGAAGTCGG + Intergenic
911089918 1:94010189-94010211 AGGTAGGACTGGATTGCAGAGGG + Intronic
912409330 1:109468757-109468779 AAGGATGGCAGGATTGAAGAAGG - Intronic
915528140 1:156488621-156488643 AAGGAGGACTGGTTTGGAGGGGG + Intronic
916394679 1:164372698-164372720 AAGCAGGAATTGATTGAATTAGG - Intergenic
918824677 1:189308903-189308925 AAATAGGACTGCATAGAAGTAGG + Intergenic
919014119 1:192007559-192007581 AACGAGGAGAGGATTGAATTTGG - Intergenic
920272447 1:204776121-204776143 AAGGAAAGGTGGATTGAAGTAGG - Intergenic
920727105 1:208446270-208446292 AGGGAGGACTAGATTGCAGCTGG - Intergenic
921379003 1:214504821-214504843 AAGTAGGACTGGCTTGGACTAGG + Intronic
921774056 1:219076825-219076847 AAGCAGTGCTGGATTAAAGTAGG - Intergenic
922912943 1:229232722-229232744 AAGGAGGAATGGATGGATATTGG + Intergenic
923102993 1:230831974-230831996 AAGGAGGATGAGTTTGAAGTTGG - Intergenic
1063088795 10:2842953-2842975 AAGGAGGATGGGACTGAAGGAGG + Intergenic
1063603311 10:7501156-7501178 GAGGAGGAGTGGAGTGGAGTCGG + Intergenic
1063968199 10:11363149-11363171 ATGGAGTACTGGGCTGAAGTGGG - Intergenic
1064813966 10:19235201-19235223 AAGGGGGACACGTTTGAAGTAGG + Intronic
1064894456 10:20218369-20218391 AAGGTGAACTGGAATAAAGTGGG + Intronic
1066029175 10:31400057-31400079 AAGGAGAATTGGGGTGAAGTAGG - Intronic
1067601837 10:47612126-47612148 GAGAAGGGCTGGATTGGAGTGGG + Intergenic
1067838498 10:49656746-49656768 AAGAAGGACTGGTTGGAATTGGG + Intronic
1068966052 10:62912989-62913011 CAGGAGGATTGGGTTAAAGTGGG - Intronic
1069259246 10:66373327-66373349 AAGGAAGACTGGATTTATATAGG - Intronic
1070694017 10:78548487-78548509 AAGGAGGAATGGATGGAAAGAGG + Intergenic
1071168522 10:82834924-82834946 AAGGAGGACCAGATTGAAAATGG - Intronic
1073139866 10:101239941-101239963 ATGCAGGACAGGCTTGAAGTGGG + Intergenic
1073505042 10:103978883-103978905 AAGGAGGAAGGGATGGAAGGAGG - Intronic
1074200246 10:111228202-111228224 AAGGAGGCCTGGATGGATGCTGG - Intergenic
1074496197 10:113982157-113982179 AATGAAGAGGGGATTGAAGTTGG + Intergenic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1075637876 10:124042637-124042659 AAGCATGCATGGATTGAAGTGGG - Intronic
1077896110 11:6454713-6454735 AAGGACGACTGGACAGAACTGGG + Intronic
1078638375 11:13073601-13073623 AATGAGGATTGGATTGCAGAAGG - Intergenic
1081792762 11:45800418-45800440 ATGGAGGAATGGACAGAAGTTGG - Intergenic
1082893657 11:58166755-58166777 AAGGAGGAAAGAAATGAAGTCGG + Intronic
1086129904 11:83390303-83390325 AAGGAGGACTGGCTTGGTGAGGG + Intergenic
1087546139 11:99586199-99586221 AGCTAAGACTGGATTGAAGTGGG - Intronic
1088594000 11:111426289-111426311 AAGGAGGACTGGATTGAGAGTGG + Intronic
1089590588 11:119537937-119537959 GAGGAGGAGTCTATTGAAGTGGG + Intergenic
1090306204 11:125693367-125693389 AAGGAGGGATGGAGTGAGGTGGG - Intergenic
1090419740 11:126566275-126566297 AAGGAAAAATGGATTGGAGTAGG + Intronic
1090985485 11:131762357-131762379 AAGGATCACAGGATTAAAGTTGG + Intronic
1091186034 11:133648873-133648895 AAGGAGGCCAGGACTGAAGGAGG + Intergenic
1092463514 12:8707273-8707295 AAGGCTGACTGGCTTTAAGTTGG + Intronic
1094321003 12:29183071-29183093 AATGAGGACTGGAATGCAATTGG - Intronic
1094426096 12:30318784-30318806 AAGCAGGAGTGCATTGAAATAGG + Intergenic
1095735225 12:45548714-45548736 AAGAAGGACTGGATAGGAGAAGG + Intergenic
1096149975 12:49303241-49303263 AAGGAAGACTGAAGTGAAATGGG + Intergenic
1096620971 12:52865390-52865412 GAGCAGGACTGGATTAAACTGGG - Intergenic
1098762918 12:74447377-74447399 GAGGAGGATTGGAGTGATGTTGG - Intergenic
1099338500 12:81396402-81396424 AACAAAGACTGGATGGAAGTGGG + Intronic
1101529970 12:105564809-105564831 GAGGAGCACTGGAATGAAGAGGG - Intergenic
1102221901 12:111200609-111200631 AGGGAGGCCTGGATTGAATGGGG - Intronic
1102422170 12:112812439-112812461 AAGAAAGAATGGATTGAAGAAGG + Intronic
1102881322 12:116487221-116487243 AAGGAGGACTGGGTTGGAAGAGG + Intergenic
1105443681 13:20435401-20435423 ACGGAGGTGTGGATGGAAGTCGG - Intronic
1105631077 13:22169063-22169085 AATGACAAATGGATTGAAGTAGG + Intergenic
1107216974 13:37933438-37933460 AACCAGGACTGGATTGACGTGGG - Intergenic
1107717356 13:43214169-43214191 AAGGAGGAATGGATTGGGGAAGG + Intronic
1109019690 13:57072852-57072874 AAGGAGGGCTGGTTTGAAAAGGG + Intergenic
1112973136 13:105285315-105285337 AAGGAGGCCTGAGTTGATGTGGG - Intergenic
1114642811 14:24235634-24235656 AGGGAGGACATGATTGAAGTTGG - Intronic
1117116319 14:52516974-52516996 AAGGATGACTGGAATAAAGAAGG - Intronic
1117428795 14:55630629-55630651 AATGAGGGCTGGAATGAAGAAGG + Intronic
1117769475 14:59118568-59118590 AAGCAGGACAGTATTGAAATGGG - Intergenic
1117894390 14:60465640-60465662 TAGCAGGATTGGATTGAAGAGGG - Intronic
1120005384 14:79350815-79350837 AAGGAGTTCTGGGTTGCAGTAGG - Intronic
1120393421 14:83937541-83937563 AAGGAGGATGGGATTGAACATGG - Intergenic
1120984831 14:90325506-90325528 AAAGAGGCCAGGATTTAAGTAGG - Intronic
1121331079 14:93050168-93050190 AAGGAGGACTGGGTTGCACTCGG + Intronic
1121421550 14:93819110-93819132 AAGGAGGATTCGATTGTAGAGGG - Intergenic
1122972838 14:105159292-105159314 TAGGAGCACAGGATGGAAGTGGG + Intronic
1123826872 15:24091492-24091514 AAGGAGGAATAGATAGAAGAGGG + Intergenic
1123841479 15:24252356-24252378 AAGGAGGAATAGATAGAAGAAGG + Intergenic
1123856261 15:24415323-24415345 AAGGAGGAATAGATAGAAGAGGG + Intergenic
1124577970 15:30926245-30926267 AAGGAACACTGAATGGAAGTGGG - Intronic
1124803250 15:32855994-32856016 AAGGTTGTCTGTATTGAAGTAGG - Intronic
1127374325 15:58369185-58369207 AAGGAGGCGTGGAGAGAAGTGGG - Intronic
1128648797 15:69395884-69395906 AAAGTGGGCTGGAGTGAAGTTGG + Intronic
1128933587 15:71726956-71726978 AAGGAGGACTGGTTTAGAGAAGG - Intronic
1131443403 15:92475841-92475863 AAGGAGGAAGGCATTGAAATGGG - Intronic
1132095378 15:98980606-98980628 AAAGAGGACAGGATAGAAGTGGG + Intronic
1134778482 16:16873491-16873513 AAGAGGGACTGGATAGATGTGGG + Intergenic
1137536355 16:49329766-49329788 AAGGAGGAGTGGTATGAAATGGG - Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138647658 16:58436880-58436902 AAGGAGGGATGGATGGAAGAGGG - Intergenic
1139761670 16:69188789-69188811 AGGGAGGAAAGGAATGAAGTTGG + Intronic
1140628322 16:76821563-76821585 AAGAAGGGCTGTATTCAAGTGGG + Intergenic
1140763922 16:78138442-78138464 AAGGAGGACAGGAGTGAATCTGG + Intronic
1141265272 16:82490939-82490961 AAGGAGGAGTGGACAGCAGTAGG + Intergenic
1141740994 16:85892884-85892906 AAGGAGGACAAGATTTAAGGTGG + Intergenic
1142584342 17:961652-961674 AGGGAGGACTTGATTTAAGAAGG - Intronic
1143889360 17:10090838-10090860 AAGGAGTGCTGGATTGGACTTGG - Intronic
1146290115 17:31600734-31600756 ATGGAGGACTGGAGTGGGGTAGG - Intergenic
1146466610 17:33091195-33091217 AGGGAGGACTGGATGGAATGAGG + Intronic
1146820905 17:35983009-35983031 AAGGAGGAATGGATGGAGGGAGG - Intergenic
1147270310 17:39265234-39265256 AAGGAGTACATGAGTGAAGTAGG - Intronic
1149784621 17:59424441-59424463 AAGGAGGTTTGGATGGAGGTAGG + Intergenic
1153527877 18:6014957-6014979 CAGTAGGAGTGGACTGAAGTGGG + Intronic
1154029472 18:10740154-10740176 AAAGAGGACTGGATTGGAATGGG + Intronic
1156334559 18:36157460-36157482 ACTGAAGACTGGATAGAAGTGGG + Intronic
1157429928 18:47616289-47616311 AATGAGGAGAGGATAGAAGTAGG + Intergenic
1159316028 18:66774013-66774035 TAAGATGACTGGATTGAAGTGGG + Intergenic
1159682167 18:71368322-71368344 AGGGAGGACTGGGGAGAAGTAGG + Intergenic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1163463787 19:17454949-17454971 AGAGAGGGCTGGATGGAAGTCGG - Intronic
1164937078 19:32223373-32223395 AAGGAGGAAGGGATTAAAGGAGG + Intergenic
1167714214 19:51130792-51130814 ATGGAGGAGTGGACTGAAGTGGG - Intronic
926400066 2:12487924-12487946 AGGGAGCCCTGGATTGATGTGGG - Intergenic
927196704 2:20552773-20552795 CAGGAGCACTGGATTGAACTAGG - Intergenic
927496708 2:23555984-23556006 AGGGGGGACTGGATTGCAGCAGG + Intronic
929438816 2:41949364-41949386 AAGGAAGACTGGAATGGGGTGGG + Intronic
933377801 2:81502236-81502258 AAGGAGGAGTGGGTGGAAGGAGG + Intergenic
933851454 2:86370033-86370055 AAGGAGGATTTGACTGAACTTGG + Intergenic
935362823 2:102262101-102262123 AAGGAAGACTGGCTTGATATGGG + Intergenic
935368762 2:102322575-102322597 GAAGAGAACTGTATTGAAGTCGG - Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936761710 2:115793222-115793244 AGGTAGGACTGGGTTCAAGTTGG + Intronic
937380416 2:121371630-121371652 AAGGAGGCCTGCTTTGAAGCGGG - Intronic
938029603 2:127981329-127981351 CAGGAGGACTGGGTTGGGGTGGG - Intronic
938343494 2:130550196-130550218 ATGGAGGAGTGGGTTGAACTCGG - Intergenic
938346339 2:130570526-130570548 ATGGAGGAGTGGGTTGAACTCGG + Intergenic
938620550 2:133048187-133048209 AAAGAGCACTGGATTGGACTGGG + Intronic
941656253 2:168147925-168147947 AAGTAAGTCTGGATTGCAGTTGG - Intronic
942402002 2:175612734-175612756 AAGGGGGAGTGGACTCAAGTGGG + Intergenic
942813724 2:180026607-180026629 AAGGAGAAATAGAGTGAAGTGGG + Intergenic
944593024 2:201236162-201236184 CAGGAGGACAGGATTCAAGAGGG - Intronic
945756387 2:213852471-213852493 AAGGAGGACTGTGTTGAGGATGG - Intronic
946040073 2:216775544-216775566 AAGGAGGACTGGAATGAGGTTGG + Intergenic
946822981 2:223649002-223649024 AAGGAGGAGAGGCTAGAAGTGGG + Intergenic
948469293 2:238167023-238167045 CAGGAGGACAGCACTGAAGTGGG - Exonic
1169575494 20:6955720-6955742 CAGGAGGACTGACTTGGAGTAGG - Intergenic
1170029824 20:11933075-11933097 AAGGAGGATTGGCTGGAAGAGGG + Intergenic
1170046811 20:12094044-12094066 AATGAGGATTGGAGTGAAGGTGG + Intergenic
1170607502 20:17884822-17884844 GAGGATGAGTGGATAGAAGTGGG - Intergenic
1170942489 20:20859994-20860016 ATGGAGGACTTGATGGAAATGGG + Intergenic
1172526443 20:35602744-35602766 AAGAAGTACTGAATTGAAGTGGG + Intergenic
1173015873 20:39225347-39225369 AGGGAAGAATGGATTGAAGCTGG + Intergenic
1173586573 20:44187213-44187235 AAGGAGGGCAGGATTGGAGAAGG - Exonic
1174746976 20:53073030-53073052 AAGGAGGAATGGATGGAGGAAGG - Intronic
1176980913 21:15379932-15379954 AAAGAGCACTGGACTGAATTGGG - Intergenic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1178806711 21:35845482-35845504 AAGGGGGCCTGGGTTGGAGTAGG - Intronic
1182008190 22:26978963-26978985 ATGGAGGATGGGATTGAGGTAGG - Intergenic
1184113734 22:42410001-42410023 AAGGAGGACTGGATGCCAGCAGG - Intronic
1184641886 22:45877233-45877255 CAGGAGGACTGGATTAGAATGGG + Intergenic
1185419427 22:50727269-50727291 AAGGAGAACTGGTAAGAAGTGGG + Intergenic
949538934 3:5017307-5017329 AAGGTGGACAGGAGAGAAGTTGG + Intergenic
950489860 3:13297604-13297626 AAGGAGGAGTGCAGAGAAGTTGG - Intergenic
951736784 3:25874931-25874953 AAAAAGGACTGGGTAGAAGTGGG - Intergenic
952078763 3:29731538-29731560 AAGAAGGACTGCAAAGAAGTAGG - Intronic
953701147 3:45196747-45196769 AAGGAGGAATGGGCTGAAGGAGG + Intergenic
953957412 3:47242317-47242339 AAGGGGAATTGGATTGATGTGGG + Intronic
954446576 3:50550134-50550156 AAGCAGGTCTGGACTGGAGTTGG - Intergenic
955498699 3:59562949-59562971 TACGAGGACTGGATTGGAGAGGG - Intergenic
956919468 3:73911878-73911900 AAGCAGGTCTGAATTGAAGGAGG - Intergenic
957041039 3:75335798-75335820 AAGGAGGAATGGATTAAAGTTGG - Intergenic
958259611 3:91365159-91365181 GAGGAGGACAGGATGGTAGTGGG - Intergenic
958616244 3:96496323-96496345 AATGAGGTCTGTAATGAAGTGGG - Intergenic
958788004 3:98620116-98620138 AAGGAGGACTGGTTAGACCTGGG + Intergenic
958806714 3:98819774-98819796 AAGGAGGACTGGATTGAAGTTGG - Intronic
960815615 3:121668828-121668850 GAGGAGTACAGCATTGAAGTTGG - Intronic
961045847 3:123707453-123707475 AAGGAGGAATGGATCAAAGTTGG - Intronic
962343591 3:134604358-134604380 AAGGAAGAATGGGATGAAGTTGG - Exonic
964818378 3:160741798-160741820 AAGGAAGACTGTATAGAAGATGG + Intergenic
965970103 3:174544096-174544118 AAGAAGGACTGGATTGGGGTGGG - Intronic
967842877 3:194021004-194021026 AAGTCATACTGGATTGAAGTGGG + Intergenic
967977628 3:195044370-195044392 AAGGTGGCCTGGTTTGATGTGGG - Intergenic
968741291 4:2333006-2333028 AAGGGGGCTTGGATTGAAGGAGG - Intronic
969306282 4:6327912-6327934 AAGCAGGGCTGGATCCAAGTGGG - Intronic
969871424 4:10107332-10107354 CAGGAGGACTGCATTGAAAATGG - Intronic
970402751 4:15733668-15733690 AAGGAGGAAGGGAGTGAAGGGGG + Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
972001913 4:34047802-34047824 AAGGAAGAGAGGATAGAAGTGGG + Intergenic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
972995616 4:44875460-44875482 AAGGCTTAATGGATTGAAGTTGG - Intergenic
975704195 4:77095640-77095662 ATGGGGGAGTGGAATGAAGTGGG + Intergenic
977179473 4:93856771-93856793 AAAGGGCACTGGAGTGAAGTGGG + Intergenic
978179727 4:105778043-105778065 AAGGAAGACTTGATTGGAGTTGG + Intronic
978433088 4:108653742-108653764 AAAGAGGCCTGTGTTGAAGTTGG + Intronic
978455982 4:108892153-108892175 AATGAATACTGGATTAAAGTAGG + Intronic
978470807 4:109065283-109065305 AGGGAGGACTGTTTAGAAGTAGG + Intronic
980843081 4:138290312-138290334 AAGGGGGAGTGAATTGAAATAGG - Intergenic
984139670 4:175988189-175988211 AAAGAGAAGTGCATTGAAGTGGG - Intronic
984607282 4:181800139-181800161 AATGAGGACTAGATTCAAGATGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986009058 5:3695474-3695496 CAGGTGGTCTGGATTGAAGATGG - Intergenic
986184886 5:5426000-5426022 AAGGTGGAAGGGACTGAAGTTGG + Intronic
986652443 5:9978080-9978102 ATGGAGGTTTGCATTGAAGTGGG + Intergenic
987715176 5:21559222-21559244 AAGGAAGACGGGAGTGAAGGAGG + Intergenic
990058724 5:51619371-51619393 AATGAGAAGTGGTTTGAAGTGGG + Intergenic
993197339 5:84765195-84765217 AAAGAGTACTGGATTGTAGGGGG - Intergenic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
995095001 5:108225428-108225450 AAGTTGTACTGGAGTGAAGTGGG + Intronic
996411658 5:123165140-123165162 AAGGAGGTCTGGATTGAAAATGG - Intronic
997979238 5:138458838-138458860 AAGAAGGAGTGGGTGGAAGTGGG - Intergenic
998414058 5:141932727-141932749 AAGGAGGAATGGTTTATAGTAGG + Intronic
1000207353 5:159075286-159075308 AAGGAGGAAGGGACTGAAGAGGG - Intronic
1000682582 5:164204374-164204396 AAGGAATACTGGAGTAAAGTGGG + Intergenic
1001758611 5:174189471-174189493 AAAGAGTCCTGGATGGAAGTTGG - Intronic
1002166718 5:177352121-177352143 AAGGAGCTCTGAATTGAAGGCGG + Intergenic
1003621158 6:7701653-7701675 AAGGAGGAAGAGAGTGAAGTGGG + Intergenic
1003700184 6:8455849-8455871 AAGGAGCACTGGTCTGGAGTAGG - Intergenic
1005259950 6:24048166-24048188 GAGGAGGACTGGGTGGAACTGGG - Intergenic
1006388868 6:33747084-33747106 AAGGAGGACTGGTCTGAGGCAGG + Intergenic
1006864309 6:37196457-37196479 AAGAAGCACTGGATTTAAATTGG + Intergenic
1007104924 6:39277087-39277109 AAGGAGGTTTGCATGGAAGTAGG - Intergenic
1008995621 6:57655203-57655225 GAGGAGGACAGGATGGTAGTGGG + Intergenic
1009001544 6:57722823-57722845 AAGGAGGAAGGGAGTGAAGGAGG - Intergenic
1009184149 6:60553981-60554003 GAGGAGGACAGGATGGTAGTGGG + Intergenic
1010326594 6:74570642-74570664 GAGGAGGACAGGAATGAAGCAGG + Intergenic
1011287345 6:85739076-85739098 AAGGAGGACTTTATTCAAGGGGG + Intergenic
1011524334 6:88246984-88247006 ATGGAGGACTGAACCGAAGTGGG - Intergenic
1011697822 6:89929057-89929079 GGGGAGGACTGGATTTAGGTGGG + Exonic
1014643073 6:123938062-123938084 AAAGAAGACTGGATGGAGGTAGG - Intronic
1014883760 6:126754839-126754861 AAGGATGACTTTATTGAAGTAGG + Intergenic
1014889059 6:126819595-126819617 AAAGAGGCCTGGATGGAGGTAGG - Intergenic
1015074987 6:129145512-129145534 AAGGAAGACTGGTGTGAAATTGG + Intronic
1015364325 6:132380102-132380124 AAGGAAGACTTGATAGAAGCAGG - Intronic
1017339782 6:153307166-153307188 AAGGAGGACTAGACTTTAGTGGG - Intergenic
1018257692 6:161939088-161939110 GAGCAGTCCTGGATTGAAGTTGG - Intronic
1019985269 7:4650836-4650858 GATGAGGACTGGATTGCAGCAGG + Intergenic
1021158030 7:17236120-17236142 AAGGAGGATAGAATTTAAGTAGG - Intergenic
1021229481 7:18068522-18068544 AAAGAGGACTGGGTTGATTTGGG + Intergenic
1021540498 7:21752040-21752062 CAGGAGGTCTGGCTTGGAGTTGG - Intronic
1024132522 7:46369134-46369156 CAGGAGGTCTGGGTTGAGGTAGG - Intergenic
1024237742 7:47410547-47410569 AAGGTGGAGAGGATTGAAGGTGG - Intronic
1026509357 7:71015680-71015702 AAGGAGGACTGGAGTGAGTTCGG + Intergenic
1026775850 7:73230553-73230575 AAGGAGGGCTGCCTGGAAGTGGG + Intergenic
1027016708 7:74783925-74783947 AAGGAGGGCTGCCTGGAAGTGGG + Intronic
1027071320 7:75162011-75162033 AAGGAGGGCTGCCTGGAAGTGGG - Intergenic
1028229014 7:88283817-88283839 CAGGAGCACTGGATGCAAGTCGG - Exonic
1029693546 7:102198518-102198540 AGGGAGGACTGCCTTGAAGGAGG - Intronic
1029994312 7:104991814-104991836 AAGGAGGGATGTATAGAAGTTGG + Intergenic
1029994662 7:104995591-104995613 AAGGAGGGATGTATAGAAGTTGG + Intergenic
1031224755 7:119021650-119021672 CTGGAGGACTGGATTGATGGTGG + Intergenic
1032497941 7:132376822-132376844 AAGGAGGACTGGGTGCAGGTGGG - Intronic
1034029724 7:147747220-147747242 AAGGAGGACATGATTGAAGGAGG - Intronic
1034163495 7:149009017-149009039 AAGGAGAATTGGCTTGAACTTGG - Intronic
1035786869 8:2268438-2268460 AAGGAGCAGTGGATGGAAGCAGG - Intergenic
1035805938 8:2453278-2453300 AAGGAGCAGTGGATGGAAGCAGG + Intergenic
1036540575 8:9704285-9704307 AAGGAGGACAGGATTTAAGTAGG + Intronic
1039747758 8:40445522-40445544 AAGGAGGAAAGGATGGAAGGAGG - Intergenic
1042019362 8:64354507-64354529 AAGGAAAACTGCATTGAAGATGG - Intergenic
1042605337 8:70540615-70540637 AAGGAGGACTAGAATGAAGGGGG - Intergenic
1042605596 8:70542457-70542479 AAGGGGGACTAGAGTGAAGGGGG - Intergenic
1043114706 8:76235762-76235784 ATGGAAGAATAGATTGAAGTAGG + Intergenic
1045409543 8:101903549-101903571 AATGAGGACTGTAGAGAAGTTGG + Intronic
1046280556 8:112023949-112023971 TAGGAGGCCTGGAGTGGAGTAGG - Intergenic
1047955114 8:129968874-129968896 AAGGAGGCCTGGACTCAAGGTGG - Intronic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1052821223 9:33139178-33139200 AAGGAGGAGTGGGTTGAGGTAGG + Intronic
1052955832 9:34252663-34252685 AACGAGGACAGGTCTGAAGTGGG - Exonic
1053450073 9:38186249-38186271 AAGGAGGGCAGGATTAAAGGTGG + Intergenic
1055858350 9:80718900-80718922 AAGTAGTACTGGATTAGAGTGGG - Intergenic
1056449446 9:86701642-86701664 AAGAAAGACGGAATTGAAGTGGG - Intergenic
1059780026 9:117516421-117516443 AGGAAGGACTGGAGTGAAGTGGG + Intergenic
1060129880 9:121085985-121086007 AAGGAGAACTGGAAGGAAGGTGG + Intronic
1060256803 9:122038278-122038300 AAGGAGCACTGGATTAAGCTGGG - Intronic
1060519602 9:124286928-124286950 AAGGAAGAGGGGAGTGAAGTAGG - Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1062586732 9:137252968-137252990 AAGGAGGCCTGGAGAGAAGAGGG + Intronic
1187204233 X:17166986-17167008 AAAGAGGACTGGATTAAGATTGG + Intergenic
1188177579 X:27010967-27010989 AAGGGGGACTGGAGAGAAGGGGG - Intergenic
1189333240 X:40155485-40155507 AAGGAGGAGTGGGAGGAAGTGGG + Intronic
1190439866 X:50466694-50466716 AAGGAGGGCTGCATTGAACTAGG + Intronic
1192115051 X:68402082-68402104 AAGGAGAAAGGGATAGAAGTTGG + Intronic
1193843345 X:86437414-86437436 TAGGAGGAATGGATAGAAGTTGG - Intronic
1194752707 X:97702520-97702542 AAAGAGGACTGGAGTTAAGAAGG - Intergenic
1197361486 X:125509397-125509419 AAGGCTGACTGAATTGAGGTTGG + Intergenic
1200907960 Y:8504316-8504338 AAGTAGGATTGAATAGAAGTAGG + Intergenic