ID: 958811524

View in Genome Browser
Species Human (GRCh38)
Location 3:98865444-98865466
Sequence GGGTTGAAGGGGGAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 579}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958811524 Original CRISPR GGGTTGAAGGGGGAGTTGGA GGG Intronic
900015077 1:142767-142789 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900016680 1:155589-155611 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900045344 1:501376-501398 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900046941 1:514181-514203 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900067541 1:743106-743128 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900069144 1:755899-755921 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
900100062 1:958580-958602 GGGCTGAAGAGAGAGTTGCAGGG - Intronic
900162074 1:1228582-1228604 GGGGTGAAGCTGGAGATGGACGG - Exonic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
901647351 1:10723802-10723824 AGGTTGCAGGGGGAGTTAGAGGG - Intronic
901769891 1:11524773-11524795 GGGATGATGGGGGAGATGGTAGG - Intronic
901769905 1:11524814-11524836 GGGATGATGGGGGAGATGGTAGG - Intronic
901864691 1:12096990-12097012 GGGTTGGAGGTGGAGCTGGGAGG + Intronic
902838069 1:19059356-19059378 GGGTTCAAGGGGGGGGTGGGAGG + Intergenic
902953445 1:19906629-19906651 GGGTTGAATGGGCAGGTGGTGGG + Intronic
903429303 1:23280340-23280362 GGGTGGAAGGGAGAGGGGGATGG + Intergenic
903656950 1:24955312-24955334 GGGCAGAAGGGAGAGTTTGACGG + Intronic
905029853 1:34874821-34874843 GGGTGGGAGGGGGAGTGGGCAGG + Intronic
905978894 1:42204709-42204731 GGGTTTATGGGGCAGTTGGGGGG - Intronic
906123786 1:43413806-43413828 GGGTAGCTGGGGGAGGTGGAAGG + Intronic
906306598 1:44723925-44723947 GGGCTGAAGGGGGAGGAGGAAGG - Intronic
906360244 1:45150582-45150604 GGGCAGAAAGGGGAGCTGGAAGG - Intronic
906794768 1:48688123-48688145 GGGATGAAGGGAGAGAAGGAGGG + Intronic
907066684 1:51491326-51491348 TGGTTGAGGTGGGAGTTGAAAGG - Intronic
907334569 1:53691800-53691822 GGGTTGGAGTGGGGGTAGGAGGG - Intronic
907381822 1:54096972-54096994 GGGAAGAAGGGGTAGTTGGCTGG - Exonic
907724649 1:57007882-57007904 GGGTGGATGGGGGAATGGGATGG + Intronic
908426836 1:64015642-64015664 GGGTTGAAGGTGGTATTGTAAGG + Intronic
908715330 1:67063669-67063691 GGGTAGGAGGGGGAGTGGAACGG + Intergenic
909263566 1:73527039-73527061 TAGTAGATGGGGGAGTTGGAAGG - Intergenic
909268887 1:73598163-73598185 TGGTTGAAGTGGTAGTTGGTTGG - Intergenic
909354834 1:74696668-74696690 GGTTTGAAGGGCAAATTGGAGGG + Intergenic
910399934 1:86828369-86828391 AGGATCAAGGGGGAGTTGGGAGG + Intergenic
910753252 1:90657414-90657436 GGGTTGAGGGAGCAGTTGCATGG - Intergenic
912223498 1:107704294-107704316 GTCTTCAAGAGGGAGTTGGATGG - Intronic
913093057 1:115492888-115492910 AGGTTGAGGTGGGAGCTGGAAGG - Intergenic
913189808 1:116403998-116404020 TGGTTGGAGGAGGAGTGGGAGGG + Intronic
915562283 1:156694242-156694264 GGGTGGGAGGGGAAGCTGGAGGG + Intergenic
915940605 1:160116128-160116150 GGGGTGGAGGGAGAGATGGAGGG - Intronic
916055886 1:161068831-161068853 GGCTTGAAGCTGGAGGTGGAGGG - Intronic
916273399 1:162968137-162968159 GGGTTCAAGAGTGAGTGGGAAGG + Intergenic
916500440 1:165382677-165382699 AGGTTGAAGGGGGAGTTCGAAGG - Intergenic
916951572 1:169785482-169785504 GGGATGGATGGGGAGCTGGAAGG + Intronic
917856292 1:179102932-179102954 GGTTTACAGGGGGAGGTGGATGG - Exonic
917970225 1:180201455-180201477 GGGGTGAAAGGGGTGTTGAAGGG - Exonic
918469386 1:184855572-184855594 GGGTTGAAGGGGGAGAGGTCAGG - Intronic
918708838 1:187703246-187703268 AGGTGGATGGGGGAATTGGATGG - Intergenic
918983729 1:191596365-191596387 GGTTTGAAGGTGGAGTTTCATGG + Intergenic
919434172 1:197535980-197536002 GCATTAAAGGGGGAGTGGGAGGG + Intronic
919790191 1:201285636-201285658 GGGATGGAGTGGGAGTGGGAAGG - Intronic
920044789 1:203126343-203126365 GGGTGGCAGGGGGAGTAGGCAGG + Intronic
920675977 1:208039018-208039040 GAGTTGAAGGAGTAGTTTGAGGG + Intronic
920814100 1:209314916-209314938 GGGTAGGGGTGGGAGTTGGATGG - Intergenic
921350280 1:214227553-214227575 GGAATGGAGGGGGAGTGGGATGG + Intergenic
922102144 1:222485879-222485901 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922104505 1:222501291-222501313 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922263227 1:223960990-223961012 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922264823 1:223973804-223973826 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
922707095 1:227795524-227795546 GGGAAGAAGGGGGTGGTGGAGGG - Intergenic
923280435 1:232438114-232438136 GGGGTGAGGGGGGACTTTGAAGG + Intronic
923482467 1:234397493-234397515 GGGGGGAAGGGGGAGGGGGAAGG + Intronic
923513728 1:234675617-234675639 GAGTTGAAGGTTGAGTTAGAAGG - Intergenic
923990118 1:239426974-239426996 GGGTTGAAGGGAGGGGTGGGTGG + Intronic
924101109 1:240603514-240603536 GTGCTGGAGGGGGAGATGGATGG - Intronic
924345067 1:243065999-243066021 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
924346680 1:243078810-243078832 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1063019926 10:2117349-2117371 GGGATGGATGGGGAGCTGGAAGG + Intergenic
1063121192 10:3106611-3106633 GGGGTGAAGGGGCAGTGGCAGGG - Intronic
1063126530 10:3141291-3141313 GGGTTGAAGGGAGAGGTGGTGGG + Intronic
1063213860 10:3906207-3906229 GGGTGGAAAGGGGAGGAGGAAGG + Intergenic
1063523405 10:6761127-6761149 GAGATGGATGGGGAGTTGGAAGG - Intergenic
1064032260 10:11890392-11890414 GGGCTGAAGGTGGAGATGGCAGG + Intergenic
1064602409 10:17007179-17007201 GGGTTGCAGGGGGAGGGGGTGGG - Intronic
1065128663 10:22598683-22598705 GGTGGGAAGGGTGAGTTGGAGGG - Intronic
1065256248 10:23871616-23871638 GGGTAGAAGGGGGAGATGTTTGG - Intronic
1066729669 10:38426039-38426061 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1066731267 10:38439078-38439100 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1066998366 10:42584026-42584048 TGGCTGCTGGGGGAGTTGGAGGG - Intronic
1067480933 10:46597391-46597413 GGGGGGAAGGGGGGGTTGGGGGG - Intergenic
1068072107 10:52207812-52207834 GGGCTGAAGGGGGAGTAAGCTGG - Intronic
1068201290 10:53787339-53787361 GGGTTAAAAGGGGACTGGGATGG - Intergenic
1068969296 10:62946127-62946149 TGGTTGAGGGGTGAGTTGGCTGG - Intergenic
1069408311 10:68126187-68126209 AGGTTGAAGAGGTAGGTGGAAGG + Intronic
1069797866 10:71064739-71064761 GGGTGGAAATGTGAGTTGGACGG - Intergenic
1070732645 10:78841939-78841961 AGGTTGAAGAGGGAATGGGAGGG + Intergenic
1070755262 10:78988056-78988078 GGGTTGAAGGGGGTGGGGGTTGG + Intergenic
1071511625 10:86265961-86265983 GGGCTGAAGGGGGAGGTGAATGG - Intronic
1071767874 10:88689401-88689423 AGGGTGAAGGGAGAGTGGGAAGG + Intergenic
1071937573 10:90548411-90548433 GGGTTGAATGGGGATGTGGTGGG - Intergenic
1071996904 10:91158420-91158442 GATTTGAAGGGGGAGGAGGAAGG + Intergenic
1072227983 10:93387715-93387737 GGGTAGCTGGGGGAGTCGGAAGG - Intronic
1072732426 10:97855541-97855563 GGGGTGAGGGGCCAGTTGGAGGG - Intronic
1074783016 10:116815718-116815740 CGTTTGGTGGGGGAGTTGGAGGG - Intergenic
1074846022 10:117398645-117398667 GGGATGAAGGGGGCCTTAGAAGG + Intergenic
1075801150 10:125154243-125154265 GGGGTGAGGGGGGAGAGGGAGGG - Intronic
1076059707 10:127404201-127404223 GGGTGGGAGGGGGAGATGGTGGG - Intronic
1076971671 11:137867-137889 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1076973270 11:150658-150680 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1077341471 11:2028241-2028263 GGGCAGAAAGGGGAGCTGGACGG - Intergenic
1077370153 11:2177981-2178003 GGGCTGGAGGGGGAGTAGGACGG - Intergenic
1077370256 11:2178347-2178369 GGGCTGGAGGGGGAGTAGGACGG + Intergenic
1078702778 11:13704248-13704270 AGGCTGAAGGGAGAGATGGATGG + Intronic
1079340181 11:19605256-19605278 GGGTTGAAGGGGCAGCTGGATGG - Intronic
1079475040 11:20821172-20821194 GGGTTGCAGAGGTAGGTGGAGGG + Intronic
1079683501 11:23326967-23326989 GGGTGGAGGGGGGAGAGGGAGGG + Intergenic
1080502661 11:32885485-32885507 GGGATGGATGGGGAGCTGGAAGG - Intergenic
1081075461 11:38667805-38667827 GAGGTGGATGGGGAGTTGGAAGG + Intergenic
1081305213 11:41503520-41503542 GGGATGGTGGGGGAGATGGATGG - Intergenic
1081470717 11:43367821-43367843 GGGATGAAGGATGAATTGGAGGG - Intronic
1082633412 11:55567381-55567403 GGGGGGAAGGGGGAGGTGGGAGG - Intergenic
1083164552 11:60875454-60875476 GGGTGGAGGGGAGGGTTGGAGGG + Intronic
1083310731 11:61782310-61782332 GGGTTGAAGGGGAGGCTGGGAGG + Intronic
1083417629 11:62535881-62535903 GGGTCGGTGGGGGTGTTGGAGGG - Intronic
1084408541 11:68992758-68992780 GGGGTGAGTGGGGAGGTGGAGGG + Intergenic
1084444653 11:69196615-69196637 GGGCTGAAGGGGGAGGTTGGTGG + Intergenic
1084507036 11:69574787-69574809 CGGGTGAAGGGAGAGTTGCAGGG - Intergenic
1084892090 11:72241607-72241629 GGGGTGCAGGGGGAGATGGAGGG - Intronic
1085015128 11:73169066-73169088 GTGCTGACTGGGGAGTTGGAGGG + Intergenic
1085337241 11:75705661-75705683 GGGTTGAAGGTGAAGGTGTAAGG + Intergenic
1085339190 11:75720191-75720213 GGGTTGGGGAGGGAGTTGGCTGG + Intronic
1085414874 11:76313227-76313249 GGGATGGATGGGGGGTTGGAGGG + Intergenic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1086047496 11:82549975-82549997 GGGATGAAGGGGGTCTGGGAAGG - Intergenic
1086767180 11:90710766-90710788 GGGTGGAAGTGGGAGGTGGAGGG - Intergenic
1087137069 11:94731807-94731829 GTGTTGGAGAGGGAATTGGAGGG - Intronic
1087841296 11:102923475-102923497 AGGTTGAAGAGGGAGTTAGCTGG + Intergenic
1088252070 11:107869626-107869648 GGGGTGAAGTGGGAGCTGGCTGG - Intronic
1088448262 11:109955157-109955179 GGGGTGGATGGGGAGCTGGAAGG - Intergenic
1088802663 11:113320514-113320536 GGGATGGATGGGGAGCTGGAAGG - Intronic
1089050003 11:115537700-115537722 GCATTGAAGGGGCAGTTGTAGGG + Intergenic
1089400731 11:118162939-118162961 GGTTGGAAGGGGTGGTTGGAAGG - Exonic
1089437771 11:118485430-118485452 GGGTGGCAGGGGGAGGTGAAGGG + Intronic
1089524732 11:119089496-119089518 GGGTAGGAGGGAGAGTAGGAGGG + Intronic
1089692982 11:120198125-120198147 GGGTGGGAGGGGGAATTGGGAGG + Intergenic
1090249161 11:125239350-125239372 GGGGTGAAGGGTGAGTTACAAGG - Intronic
1090414279 11:126529932-126529954 TGGATGAAGGTGGAGATGGAGGG + Intronic
1091358765 11:134958092-134958114 AGGTGGAAGGGGGAGCTGGCTGG - Intergenic
1202824457 11_KI270721v1_random:83430-83452 GGGCAGAAAGGGGAGCTGGACGG - Intergenic
1092595916 12:10004397-10004419 GGGATGAATGGGGAGCTGGAAGG + Intronic
1094827977 12:34287047-34287069 GGCTTGAAAGGGGAGGTAGAGGG + Intergenic
1094830186 12:34296582-34296604 GGCTTGAAAGGGGAGATTGAGGG + Intergenic
1095186068 12:39201392-39201414 GGGGTGAAGGGGGAGTAAGCTGG + Intergenic
1095948442 12:47767094-47767116 GGGTAGAATGGGGAGAGGGAAGG + Intronic
1096597155 12:52703156-52703178 GGGGAGTAGGGGGATTTGGAGGG - Exonic
1097000990 12:55876511-55876533 GGATTTAAAGGGGAGTGGGAAGG - Intergenic
1097153311 12:56995166-56995188 GGGATGAAGGGAGGGTTGGAAGG - Intronic
1097173111 12:57128450-57128472 GGGCTGATGGGGGAGAGGGAGGG - Intronic
1097376666 12:58851682-58851704 GGGTTCAAGAGAGAGTGGGAGGG - Intergenic
1097710870 12:62915576-62915598 GGATTGAAGGGGAAGTGGGAGGG - Intronic
1097842854 12:64338837-64338859 GGTTTGAAGGGTGAGGTGGGAGG + Intronic
1098203437 12:68081612-68081634 TGGTTGCAGGAGGAGTTGAATGG - Intergenic
1098599838 12:72317881-72317903 GGGCTGAAGGGGCAGGAGGAAGG + Intronic
1099191769 12:79568629-79568651 GGGTGGAGGGGGGAATTGAATGG - Intergenic
1099995175 12:89770469-89770491 GGGTTGAATGGGGATGTGGTGGG + Intergenic
1100212092 12:92408219-92408241 GGGTGGAAGGGGCAGTTAAAGGG - Intergenic
1100387016 12:94112956-94112978 GGGATGGATGGGGAGCTGGAAGG - Intergenic
1100951932 12:99860410-99860432 GGGAGGAAGGTGGAGTTTGATGG + Intronic
1101219158 12:102618561-102618583 GGGTTGAGGGGGGAGGTGAAAGG - Intergenic
1101305014 12:103519725-103519747 GGGTTGGAGGGGTAGATGGAGGG - Intergenic
1101345032 12:103878931-103878953 GGGAAGAAGGAGGAGTTAGAGGG - Intergenic
1101575356 12:105992242-105992264 GAGTTGGAGGGTAAGTTGGAGGG + Intergenic
1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG + Intergenic
1102961715 12:117097733-117097755 GGGTTGCGGGGGGAGTGGAAGGG - Intronic
1103003601 12:117404777-117404799 GGGAGGGAGGGGGATTTGGAAGG + Intronic
1103027657 12:117587042-117587064 GGGTTGAGCAGGGTGTTGGAGGG - Intronic
1103425506 12:120830383-120830405 GGGAAGAAGGGGGAGGGGGAAGG + Intronic
1103425521 12:120830411-120830433 GGGAAGAAGGGGGAGGGGGAAGG + Intronic
1103425536 12:120830439-120830461 GGGAAGAAGGGGGAGGGGGAAGG + Intronic
1103425552 12:120830468-120830490 GGGAAGAAGGGGGAGGGGGAAGG + Intronic
1103948911 12:124541211-124541233 GGGATGGAGGTGGAGATGGAGGG + Intronic
1103949003 12:124541491-124541513 GGGATGGAGGAGGAGATGGAGGG + Intronic
1104205810 12:126637409-126637431 GAGTTGATGGTGGAGATGGAAGG - Intergenic
1105859324 13:24395238-24395260 GGGTTGGAGCGGGGGTGGGAGGG - Intergenic
1106028903 13:25980446-25980468 GGCCTGTAGGGGGAGTGGGAGGG + Intronic
1106546921 13:30738775-30738797 TGGTTGTAGGGGGAGCTGGCAGG + Intronic
1107015641 13:35706219-35706241 GGGTTGAAGGGGGAGGGGCAGGG + Intergenic
1107300867 13:38964344-38964366 GGGTGGTGGGGGAAGTTGGAAGG - Intergenic
1107450514 13:40504554-40504576 AGGTTGAAGAGGAAGTTGGCTGG - Intergenic
1107692680 13:42967820-42967842 GGATTGAAGGGGGAAGTGGAGGG - Intronic
1108254644 13:48598557-48598579 GGGATGGATGGGGAGCTGGAAGG - Intergenic
1108326962 13:49343315-49343337 GGGTTGTTGAGGGAGTTTGACGG - Intronic
1108695287 13:52897553-52897575 GGGTGGGAGGGGGTGTTGAAAGG - Intergenic
1108871233 13:54988590-54988612 GGATTGAAGAGAGAGTTGGTGGG - Intergenic
1109416726 13:62050665-62050687 AGGTAGAAGGGAGAGTTGGGGGG - Intergenic
1110003265 13:70232866-70232888 GGGATGGATGGGGAGTTGGAAGG + Intergenic
1111073410 13:83200062-83200084 GGGATGGATGGGGAGCTGGAAGG - Intergenic
1111982017 13:95026154-95026176 TGCTTGAACCGGGAGTTGGAGGG + Intronic
1112825821 13:103391530-103391552 GGGTTGACGGGGGATATTGAAGG + Intergenic
1113367013 13:109685484-109685506 GGGTGGAAGGAGGAGTGGGAGGG + Intergenic
1114678367 14:24460864-24460886 GGCTTGAAGGTGGAGTTGAGAGG + Intergenic
1114847729 14:26344007-26344029 GGTTTGAAGAGGGAGGTGGAAGG + Intergenic
1114927654 14:27423553-27423575 GTGTTGGAGGGGGACTTGGTAGG - Intergenic
1116249029 14:42457375-42457397 GTGTTGAATGGGGATTTGGTGGG - Intergenic
1116582788 14:46663502-46663524 GGGTGGAAGAGGGAGCTGGGTGG - Intergenic
1116869736 14:50059915-50059937 GGGTAGGAGTGGGAGTTGGGAGG - Intergenic
1118071748 14:62253092-62253114 GGGTTGAAGGTGGATGAGGAAGG + Intergenic
1119100153 14:71871969-71871991 GGGGTGGAGGGGGTGGTGGAGGG + Intergenic
1119217813 14:72882741-72882763 GGGTGGATGGGGCAGTGGGAGGG - Intronic
1121160531 14:91735297-91735319 GGGGTGAAGGGAGAGGTGAAAGG - Intronic
1121663000 14:95649858-95649880 AGAGTGAAGGGGGAGCTGGAGGG + Intergenic
1121798383 14:96754120-96754142 GTGTGGAAGGGGGAGAGGGAAGG + Intergenic
1121887325 14:97555594-97555616 GAGGTGATGGGGGAGATGGAAGG - Intergenic
1122436958 14:101706905-101706927 AGGTTAGAGGGGGAGATGGAGGG - Intergenic
1122447856 14:101782106-101782128 GGGAAGAAGGGGGAGGGGGAGGG - Intronic
1123691959 15:22845677-22845699 GGGTTGCAGGAGGAGGAGGAGGG + Intronic
1125376508 15:39035987-39036009 GGGTGGAAGGGGGAGGGGGGAGG - Intergenic
1126462322 15:48927231-48927253 GGGTGGAAGAGGGCGCTGGAAGG - Intronic
1127418365 15:58779883-58779905 AGGTTGAATGGGGAGTGAGAAGG - Intronic
1128255654 15:66194662-66194684 GGGAAGAAGGGGGAGGGGGAGGG + Intronic
1129181182 15:73876899-73876921 GGGTGGGAGGGGCAGTGGGAAGG - Intronic
1129506976 15:76089528-76089550 GGGTTGAAGGGTGAGAGGGAAGG + Intronic
1129634918 15:77305221-77305243 GGGTGGGAGGGAGAGATGGAGGG + Intronic
1129682003 15:77663387-77663409 GGGTGGCAGGGGGAGGTGGCAGG - Intronic
1130541488 15:84823468-84823490 GGGGTGAGGGGAGAGCTGGAGGG + Intronic
1131229213 15:90647606-90647628 GGTGTGAAGGGGGAGGGGGAGGG - Intergenic
1131828877 15:96341803-96341825 GGGTTGATTGGGGGGTGGGAGGG + Intergenic
1131899026 15:97067700-97067722 GGGAGGAAGGGTGAGTGGGAGGG - Intergenic
1132478865 16:155926-155948 GGGATGGAGGGGAAGGTGGAAGG + Intronic
1132672237 16:1106621-1106643 GGATTGGAGGTGGAGGTGGAGGG - Intergenic
1132850248 16:2021783-2021805 GGGTTGAAGAGGCAGCGGGAGGG - Intergenic
1133301489 16:4785417-4785439 AGGTTGAAGGGGGAGGGGCACGG + Intronic
1134446966 16:14338307-14338329 GGGTGGATGGGGTAGATGGATGG - Intergenic
1135514273 16:23116725-23116747 GGTTTGAAGGGTGTGGTGGAGGG - Intronic
1135971444 16:27074728-27074750 TGGTGGAATGGAGAGTTGGAAGG - Intergenic
1137558591 16:49488923-49488945 GGGGTGAGGGGGGAGTCGGTGGG + Exonic
1137948942 16:52763606-52763628 AGGATGAAGGGAGAGTTGGTTGG - Intergenic
1138207914 16:55138397-55138419 GTGTTGAGGGGGGTGTAGGAAGG + Intergenic
1138587074 16:57977593-57977615 GTGTTGGAAGGGGAGTGGGAGGG + Intronic
1139289111 16:65841082-65841104 GAGTTGACGGGGGAGATAGACGG + Intergenic
1139328047 16:66167096-66167118 TGGATGAATGGGGAGCTGGAAGG + Intergenic
1140946803 16:79776359-79776381 GGGTTGGAAGAGGAGATGGAGGG - Intergenic
1141620716 16:85235402-85235424 GGGGTGAGGGGGGTGATGGAAGG + Intergenic
1142284366 16:89165719-89165741 GGGTGGAAGAGGGAGCAGGAAGG - Intergenic
1142411135 16:89917848-89917870 GGGTGGAAGCGGGAGGGGGATGG - Intronic
1142446981 16:90146868-90146890 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1142448577 16:90159655-90159677 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1142458908 17:75634-75656 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1142460511 17:88463-88485 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1142585517 17:970382-970404 AGGATGAAGGGGGAGTTGGGGGG + Intronic
1142765223 17:2060646-2060668 GGGGTGAAGGGGGAGCTGAGGGG + Exonic
1143165713 17:4896355-4896377 GGGCTGCTGGGGGAGTGGGATGG + Intronic
1143335931 17:6171480-6171502 AGGTTGAGGAAGGAGTTGGAAGG - Intergenic
1143457857 17:7079273-7079295 GGGTTGAAGTAGGAGCTGGGTGG + Intronic
1143524345 17:7463493-7463515 TGGTGGAGGGGGGAGTGGGACGG - Exonic
1144143670 17:12376363-12376385 GGGGTGAAGGGGGAGGAGGGAGG + Intergenic
1144586289 17:16489861-16489883 GGGCTGATGGGGGGGTGGGAGGG - Intronic
1144689083 17:17247959-17247981 GGGCTGAAGGGGGAGTTTTGTGG - Intronic
1145271646 17:21407942-21407964 GGGATGAATGGGTAGGTGGATGG - Intronic
1145309858 17:21695390-21695412 GGGATGAATGGGTAGGTGGATGG - Intronic
1146008732 17:29178401-29178423 GGGTTGTAGGTGGGGGTGGAGGG - Intronic
1146126228 17:30233578-30233600 TGGTTGCAGAGTGAGTTGGAGGG + Intronic
1146172864 17:30646564-30646586 GGGTTTAGGGGGGAATGGGATGG - Intergenic
1146346321 17:32062559-32062581 GGGTTTAGGGGGGACTGGGATGG - Intergenic
1146676487 17:34776863-34776885 GGTTTGGGAGGGGAGTTGGAGGG + Intergenic
1146789322 17:35742639-35742661 GGATTGATGGGGGACTTGGAGGG + Exonic
1147125435 17:38364810-38364832 GAGGAGGAGGGGGAGTTGGAGGG - Exonic
1147190259 17:38734257-38734279 GGGGTGGAGGGGCAATTGGAAGG + Exonic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1148088148 17:45006825-45006847 GGGTTGTGGAGGGGGTTGGAGGG - Intergenic
1148147961 17:45377876-45377898 GGAAAGAAGGGGGGGTTGGATGG - Intergenic
1148148053 17:45378524-45378546 GGGGTGAAGTGGGAAGTGGAAGG - Intergenic
1148432132 17:47650565-47650587 GGGTTGGGGGGGGAGGGGGAGGG - Intronic
1148644776 17:49213460-49213482 GGGCTGCAGGTGGGGTTGGAGGG - Intronic
1148679356 17:49464864-49464886 GAGTTAAAGTTGGAGTTGGATGG - Intronic
1148751667 17:49948887-49948909 GGGCTGAGGGAGGAGTGGGAGGG + Intergenic
1148825995 17:50394843-50394865 GGGTTGAGAGGGGGGTGGGAGGG - Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149423689 17:56534511-56534533 TAGTTGAAGGGGGAGGTGGGGGG + Intergenic
1150836015 17:68564918-68564940 GGGTTCAGGGAGGATTTGGAAGG + Intronic
1151572298 17:74932891-74932913 GGGATGAGGGGAGAGCTGGAGGG + Intronic
1151612328 17:75184188-75184210 GGGTTGAGGAGTGAGTGGGAGGG - Intergenic
1151719694 17:75848053-75848075 GGGTGGAGGGTGGAGTGGGATGG - Intronic
1151840916 17:76616770-76616792 TGGTAGAAAGGGGAGTAGGATGG + Intergenic
1151889986 17:76946222-76946244 GGGTGGAAGGGCCAGGTGGATGG + Intronic
1152088075 17:78232257-78232279 GGGGTTAAGGGGGTGTCGGAGGG - Intronic
1152103354 17:78315361-78315383 GGGTTCAAGGAGGAGTTAGTGGG + Intergenic
1152150190 17:78594607-78594629 ACCTTGAAGTGGGAGTTGGAGGG - Intergenic
1152360674 17:79831840-79831862 GGGGTGACCGGGGAGTGGGAGGG + Intergenic
1152747421 17:82047833-82047855 GGGTAGAAGGGGGATATGGCAGG + Intergenic
1152773868 17:82187747-82187769 GGGTTGCGGGGGGAGCTGGCAGG + Intronic
1152935346 17:83133427-83133449 GAATTAAAGGGGGAATTGGAGGG + Intergenic
1152976117 18:220234-220256 GGGTTGCAGTGGAAGTTTGAAGG - Intronic
1153379949 18:4427292-4427314 AGGTTGGAGGTGGAGTTGGGAGG + Intronic
1153491124 18:5648854-5648876 GGGTTGAAGCGGGAGGTGTGAGG + Intergenic
1153547056 18:6218841-6218863 GGGCTGCAGGGGGAGTGGGAGGG + Intronic
1153852122 18:9104702-9104724 GGGTGGAAGGGGGAGGGAGAAGG - Intronic
1153952810 18:10071319-10071341 GGGCTGAAGGAGAAGTGGGAGGG + Intergenic
1154155923 18:11944050-11944072 GGGATGGATGGGGAGCTGGAAGG + Intergenic
1154496201 18:14963147-14963169 AGGTGGAAGGGGGAGCTGGCTGG + Intergenic
1156076148 18:33282063-33282085 GGGTTGAAGGGGGAGAAAGCTGG + Intronic
1156345129 18:36250123-36250145 GGGGTGAAAGGGGAATTGGTTGG - Intronic
1158307879 18:56126543-56126565 GTGTTTCAGGGAGAGTTGGAAGG - Intergenic
1159649275 18:70958231-70958253 GGCCTGTAGGGGGAGTTGGGGGG - Intergenic
1160266439 18:77343367-77343389 GTGTTGGAGGGGGTGTTGGGAGG + Intergenic
1160266475 18:77343457-77343479 GTGTTGGAGGGGGTGTTGGGAGG + Intergenic
1160392679 18:78546968-78546990 GGGAGGAAGGGGGAGGAGGAGGG + Intergenic
1160506178 18:79427849-79427871 TGGGTGTAGGGGGAGCTGGACGG + Intronic
1160648627 19:208147-208169 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1160650226 19:220963-220985 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1161004008 19:1925484-1925506 GTGTTCCAGGGGGAGTTGGGGGG - Exonic
1161403993 19:4081770-4081792 GAGGAGAAGGGGGAGTAGGAGGG - Intergenic
1161623012 19:5309148-5309170 GGGAGGAAGGGGGGGTTGGCTGG + Intronic
1162012103 19:7823520-7823542 GGGATGGAGGGGGAGGGGGAGGG + Intergenic
1162254912 19:9482440-9482462 GGGGGGAAGGGGGAGAAGGAAGG + Intronic
1162348373 19:10134483-10134505 GGGATGATGGGCCAGTTGGAGGG - Intronic
1162989556 19:14293533-14293555 GGGTTTAGGGGGGAATGGGATGG + Intergenic
1163190345 19:15672857-15672879 AGTTTGCAGGGGAAGTTGGAGGG - Exonic
1163238435 19:16043433-16043455 GGGATGAATGGGTAGATGGATGG + Intergenic
1163386165 19:17001770-17001792 CGGTTGTTGGGGGAGATGGAAGG + Intronic
1163560859 19:18018625-18018647 GGGAGGGAGGGGGAGCTGGAGGG - Intergenic
1163570966 19:18082091-18082113 GGGTTGAAGCAAGAGTGGGATGG + Intronic
1164707390 19:30330436-30330458 GGGCTGCAGGGGGCATTGGAGGG + Intronic
1165109539 19:33493755-33493777 GGGTTGAATGGGGAGCAGGGAGG - Intronic
1166731002 19:45059024-45059046 GGCTTGAAGGGGCAGATGAACGG - Intronic
1167504752 19:49865371-49865393 GAGTTGAAGCCGGGGTTGGAGGG - Exonic
1167579249 19:50332254-50332276 GGGTTGAGGGGGGAGTGTGGAGG - Intronic
1167693778 19:51002411-51002433 GGGTTTAAGGGGGAGTTGCAAGG + Exonic
1167769266 19:51503885-51503907 GGGTTGTAGTGGGAGGTGGTTGG + Intergenic
1168661887 19:58173797-58173819 GGATTGAATGGGGTGCTGGAAGG - Intergenic
925756477 2:7137541-7137563 GGGTTGACGAGTGAGGTGGAAGG - Intergenic
925895766 2:8470910-8470932 GGGTTGAAAGGTGACTTGAAGGG - Intergenic
925987273 2:9226554-9226576 GTGGTAAAGGGGGAGTTGGGAGG + Intronic
926506449 2:13721879-13721901 GGGATGGATGGGGAGCTGGAGGG - Intergenic
926831168 2:16963704-16963726 GGGTTGGAGATGGAGTTGGGAGG + Intergenic
927559651 2:24060989-24061011 TGGGTGAAGGTGGAGGTGGAGGG - Intronic
929536622 2:42788077-42788099 GGGTGGCAGAGGGAGTTCGAGGG - Intronic
930910037 2:56619938-56619960 GAGTTGAATGGGGATTTGGTGGG - Intergenic
931264628 2:60649802-60649824 GGGAGGAAGGGAGAGTTGGAGGG + Intergenic
933409752 2:81910246-81910268 GGGATGGATGGGGAGCTGGAAGG + Intergenic
933947573 2:87300035-87300057 GTGTTGAAGAGGTAGCTGGAAGG - Intergenic
935553863 2:104485772-104485794 GGATTCAAGGGGAAATTGGAGGG - Intergenic
936332623 2:111561542-111561564 GTGTTGAAGAGGTAGCTGGAAGG + Intergenic
936528787 2:113260579-113260601 GGGGAGAAGGGGGAATAGGAAGG + Intronic
936947337 2:117942416-117942438 GGGTTGAAGAGGGACTGGCATGG - Intronic
937074529 2:119091275-119091297 TGGATGAAGGGGTAGGTGGATGG + Intergenic
937736714 2:125299370-125299392 GGGTTGTAGGGGGTGGTGGCTGG + Intergenic
937993231 2:127675352-127675374 GGGCTGACGGTGGGGTTGGAGGG + Intronic
938009919 2:127820746-127820768 GGGCTGATGGTGCAGTTGGAGGG - Intergenic
938375434 2:130802424-130802446 GGGTTGAATGGGGATGTGGTGGG - Intergenic
938849034 2:135241561-135241583 GGGATGAATGGGGAATGGGAGGG + Intronic
940650478 2:156436147-156436169 GGGTTGGCGGGGGTGTGGGAGGG - Intronic
942568927 2:177293881-177293903 GTGTTGTAGGGGGAGAAGGAGGG - Intronic
944412307 2:199457146-199457168 GGGTGGCAGGGGGAGGTGAAAGG + Intronic
944653492 2:201855688-201855710 GGGTTGAAGGGGAGGTAGAAAGG + Intronic
945048329 2:205801037-205801059 GTGTTGATGGGGGTGTGGGAGGG + Intergenic
945070485 2:205983907-205983929 GGGTTGGAGGGGGAGGGGGGAGG + Intergenic
946025236 2:216667961-216667983 AGGGTGAAGGCAGAGTTGGAAGG + Intergenic
946712156 2:222517466-222517488 GGAATGGATGGGGAGTTGGAAGG - Intronic
946728714 2:222688052-222688074 TTTTTGAAGGGGGAGGTGGAAGG - Intronic
946987229 2:225286779-225286801 AGGATGAATGGGGAGCTGGAAGG - Intergenic
947473120 2:230415796-230415818 GGCTTGGGGTGGGAGTTGGAGGG - Intergenic
948008262 2:234629070-234629092 GGGATGAATGGGGAGCTGGGAGG - Intergenic
948210541 2:236189956-236189978 GGGTGGAAGGGGTGGCTGGAGGG + Intergenic
948229605 2:236340483-236340505 GGGTTGAGGGGTGAGTAGGGTGG + Intronic
948458457 2:238118093-238118115 GGGTGGATGGAGGAGTTGGATGG + Intronic
948695679 2:239732073-239732095 GGGTTGGGGGTGGAGTGGGAGGG - Intergenic
948935861 2:241164220-241164242 GGGCAGAAGGGGGAGGTGGGTGG - Intronic
949022633 2:241750080-241750102 GCTTTGAAGGGGGACTTGGGTGG + Intronic
1169011012 20:2250400-2250422 GGGTAGAAGGGAGAGCAGGATGG - Intergenic
1169072455 20:2741328-2741350 GGGTAGAAGGCAGAGTGGGATGG - Intronic
1169266990 20:4172757-4172779 GGGTCTCAGGGGGACTTGGAGGG + Intronic
1170550801 20:17474462-17474484 GGGTGCAAGGGAGAGATGGAGGG - Intronic
1170562480 20:17569616-17569638 GGGAAGGAGGGGGATTTGGAGGG - Intergenic
1171327266 20:24305569-24305591 GGGTTGAAGGAGGAGGAGGAAGG + Intergenic
1172432186 20:34901444-34901466 GGGCTGAAGGAGGAGGTAGATGG - Intronic
1173381951 20:42553369-42553391 GAGTGGAAGGGGGAGATAGAAGG - Intronic
1173967238 20:47121899-47121921 GGGTTGGAGGGCAAGTTTGAGGG - Intronic
1174106415 20:48165474-48165496 GGGTGGGAGGAAGAGTTGGAAGG + Intergenic
1174130389 20:48340175-48340197 GGGCTGGAGGGGCAGGTGGAGGG - Intergenic
1174385528 20:50186655-50186677 GGGTACAAGGGGGATTTGGAGGG + Intergenic
1175169751 20:57071940-57071962 AGGCTGGAGGGGGAGGTGGAGGG - Intergenic
1175755720 20:61528447-61528469 GGGGTGGAGGGGGAGAGGGAGGG + Intronic
1177385029 21:20397314-20397336 GAGTTGGAGAGGGAGTGGGAAGG + Intergenic
1177943573 21:27440629-27440651 AGGATGGAGGGGGAGCTGGAAGG - Intergenic
1179458321 21:41515053-41515075 GGGTTGAATGGGGATGTGGTGGG + Intronic
1181031647 22:20150979-20151001 GGGTTGCAGGGAGGGATGGAGGG - Intergenic
1182112645 22:27734304-27734326 GGTTTGGATGGGGAGGTGGATGG + Intergenic
1182654502 22:31879300-31879322 GGGTGGGAGGAGGAGTTGGAAGG - Intronic
1182794160 22:32978225-32978247 GGGATGAAGGGAGAAGTGGAGGG + Intronic
1182959176 22:34455838-34455860 GCTTTGAAGGGAGAGTGGGAAGG - Intergenic
1183344669 22:37300758-37300780 GGGCTGACGGGGAAGTGGGATGG - Intronic
1183732602 22:39627231-39627253 AGGCTGAGGGGGGAGATGGAAGG - Intronic
1184067572 22:42129235-42129257 GGGTTGGAGTGGGTGGTGGATGG - Intronic
1184293390 22:43509676-43509698 GGGATGAAGGGGGGGATGGATGG - Intergenic
1185311799 22:50160199-50160221 GGGGAGAAGGGGGAGGAGGAAGG - Intronic
1185336839 22:50274717-50274739 GGGGTGCTGGGGGAGGTGGAAGG - Intergenic
1185336899 22:50274843-50274865 GGGGTGCTGGGGGAGGTGGAAGG - Intergenic
1185393379 22:50574457-50574479 GGGTTGAAGGTGGGATGGGAGGG - Intronic
1185408830 22:50672452-50672474 GGGCTGAAGGAGGGGTTGGGAGG + Intergenic
949150012 3:755443-755465 GGGATGAAGGGGGAGAGAGAAGG - Intergenic
949507256 3:4739405-4739427 TGGTAGAAAGGGGAGTTGCAGGG + Intronic
949509278 3:4754224-4754246 GGGCTGAAGCAGGAGTTGCAGGG - Intronic
949895753 3:8766696-8766718 TAGTTGAAGGGGGTGTTGGGGGG - Intronic
949935774 3:9114493-9114515 GGGATGAAGGGGGAGTCACAGGG - Intronic
950032174 3:9860490-9860512 GGGAGGAAGGGGGAGGTGGCAGG - Intergenic
950134736 3:10572733-10572755 GGGTTGAAGGGGCATCTGCAGGG + Intronic
950474251 3:13205718-13205740 TGGATGAAGGGATAGTTGGATGG - Intergenic
950474286 3:13205848-13205870 TGGATGAAGGGATAGTTGGATGG - Intergenic
951146797 3:19236511-19236533 GAGTTGAAGGTGGAGTAAGAGGG + Intronic
952542606 3:34382390-34382412 GGGTTGAGGAGGGAATTGAAAGG - Intergenic
952782157 3:37111927-37111949 GGGTTGAACGGGGAGAGGGTTGG - Intronic
954623193 3:52007276-52007298 GGGTGGGAGGGGGTGTGGGAGGG - Intergenic
955250922 3:57281351-57281373 GGGTTGTAAGGGGAGCTGGGAGG + Intronic
956121836 3:65974308-65974330 GGGAAGAAGGGAGAGTGGGAGGG + Intronic
956327697 3:68071481-68071503 GGGGTGAATGGGGTGATGGAGGG + Intronic
956423425 3:69108898-69108920 GGGCTGAAGAGGAAGGTGGAAGG - Exonic
958811524 3:98865444-98865466 GGGTTGAAGGGGGAGTTGGAGGG + Intronic
958896780 3:99838323-99838345 GGGAAGCAGGTGGAGTTGGAAGG + Intronic
958930825 3:100206117-100206139 GGGTAGAAGTAGGAGTTGGTAGG + Intergenic
960012460 3:112848833-112848855 GGGCTGAAGGGGGAGGAAGATGG + Intergenic
961111792 3:124290430-124290452 GGGCTGAAGGAGGAATTGGATGG + Intronic
961348005 3:126277303-126277325 GTGTTGGAGGGGGACTTGGAAGG - Intergenic
962320899 3:134389435-134389457 GGGATGGAGAGTGAGTTGGAGGG + Intergenic
963046039 3:141103379-141103401 GGGTTGATGAGTGAGCTGGATGG - Intronic
964136573 3:153351525-153351547 GGGATAAATGGGGAGTTGGAAGG + Intergenic
965603074 3:170473648-170473670 GGGTTGAGGTGGGGGTGGGAAGG - Intronic
965701198 3:171460491-171460513 GGAGTGAAGGGGGAGTGGGGAGG + Intergenic
966347699 3:178997546-178997568 GGGATGGATGGGGAGCTGGAAGG - Intergenic
966728597 3:183131411-183131433 AGTTTGAAGGAGGAGGTGGAAGG + Intronic
967033624 3:185631433-185631455 GGGAGGGAGGGGGAGTGGGAGGG - Exonic
968089602 3:195892065-195892087 GGGCTGGAGGGGGACTTAGAGGG - Intronic
968367620 3:198199166-198199188 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
968369222 3:198211968-198211990 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
968658736 4:1789935-1789957 GGGGTGCAGGGGGAGTGGGTAGG + Intergenic
969133550 4:5011314-5011336 GGGTGGAGGGTGGATTTGGAGGG + Intergenic
969479936 4:7442075-7442097 GGGCTGAAGGAGGGGGTGGAGGG - Intronic
969479991 4:7442220-7442242 GGGCTGAAGGAGGGGGTGGAGGG - Intronic
969535712 4:7755123-7755145 GGGCTGGAGGGGGAGGTAGATGG + Intergenic
970248869 4:14093239-14093261 GGGTGGAAGAGGAAGCTGGATGG + Intergenic
970426475 4:15950651-15950673 GGCTAGAAGGGGGAGATGTAGGG - Intergenic
972256127 4:37357685-37357707 GGGTGGAAGGGGGAGAGGGCAGG + Intronic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972581936 4:40402921-40402943 GGGATGGAGGGGTAGTTTGAAGG - Intergenic
974447757 4:62008103-62008125 GGGGTGAAGGGAGAATGGGAGGG + Intronic
975818850 4:78248503-78248525 TGATTGAATGGGGAGTAGGAAGG + Intronic
975909113 4:79247685-79247707 GGGTTGAAGGGGGAGAAAGCTGG + Intronic
976026898 4:80698891-80698913 GTGTTGAAGGGGGACCTGGTGGG - Intronic
976588810 4:86828595-86828617 TGGTTGAAGGGGCGGTGGGAGGG - Intronic
978268570 4:106859061-106859083 AGGGTGAAGGGGGAGGAGGAGGG + Intergenic
978384675 4:108167849-108167871 GGGAGGAAAGGAGAGTTGGAAGG + Exonic
979114331 4:116802071-116802093 GGACTGTAGGGGCAGTTGGATGG - Intergenic
979256035 4:118608878-118608900 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
979257647 4:118621696-118621718 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
979330700 4:119418866-119418888 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
979332309 4:119431659-119431681 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
981271790 4:142854218-142854240 GGGTTGAACGGGCAGTTGCAAGG - Intergenic
982000060 4:151014577-151014599 GTGATGACGGGGGAGGTGGAGGG - Exonic
984519883 4:180788582-180788604 GGGAAGAAGGGGGAGAGGGAAGG + Intergenic
984876284 4:184370809-184370831 GGGTTGCAGACGGAGTTGTAAGG - Intergenic
985293183 4:188407026-188407048 GGGATGGATGGGGAGCTGGAAGG - Intergenic
985319180 4:188689899-188689921 GAGTTGAAGGGAGTGTTGGATGG - Intergenic
985511822 5:317860-317882 GGGTTGTTGGGGGAGGTGCAGGG - Intronic
986196106 5:5537443-5537465 GGGGAGAAGAGGGAGATGGATGG + Intergenic
986643630 5:9895160-9895182 GGGGTGATGGGGGAGAAGGAAGG + Intergenic
987587062 5:19868783-19868805 TGGCTGAATGGGGAGTTGTATGG - Intronic
989155792 5:38343632-38343654 GGGTGGAGGGAGGAGTTGTAAGG - Intronic
990110455 5:52316580-52316602 GGGTTGGAGGGGAAGAGGGAGGG + Intergenic
991648558 5:68827822-68827844 AGGATGAAGGTGGAGTAGGATGG - Intergenic
991986753 5:72296108-72296130 GGTTTGAAGGGAGAGTTTGTTGG - Intronic
992486667 5:77203694-77203716 GGATATTAGGGGGAGTTGGAAGG - Intergenic
993052308 5:82939858-82939880 AGGTAGAAGAGGGAGATGGAGGG - Intergenic
993902252 5:93592637-93592659 GAGTTGAGGGGGGACTTGGGGGG - Intronic
993926339 5:93870733-93870755 GGGTGGAAGTGGAGGTTGGAGGG + Intronic
995767491 5:115634836-115634858 GGGTAGGAGGGAGAGTTGAAAGG - Intergenic
996887859 5:128380106-128380128 GGGCTGAAGGGGTCCTTGGATGG - Intronic
997062345 5:130521994-130522016 GGATTAAAGGTGGAGTGGGAAGG + Intergenic
997793271 5:136782324-136782346 GGGTTGAGGGATGGGTTGGAAGG - Intergenic
998353125 5:141513856-141513878 GGGGTGAAGGGGGACTTAAAAGG + Intergenic
998601992 5:143593928-143593950 AGGTTGTAGGGGCAGGTGGATGG + Intergenic
999508765 5:152225904-152225926 GCTTTGGAGGGGGAGATGGAGGG + Intergenic
999698000 5:154203246-154203268 GGGTTGCGGGGGGAGGTGGAAGG - Intronic
1000003830 5:157165077-157165099 GGGTTGGAGGGGGTGAGGGATGG + Intronic
1000867960 5:166538436-166538458 GGGATGGATGGGGAGTTGGAAGG - Intergenic
1001403392 5:171459792-171459814 GGGTTGGGGGGAGAATTGGAGGG + Intergenic
1001997514 5:176174045-176174067 GGGTTGGTGGGGATGTTGGAAGG - Intergenic
1002136655 5:177111992-177112014 AGGTAGAAGGAAGAGTTGGAGGG + Intergenic
1002726843 5:181304395-181304417 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1002728500 5:181317553-181317575 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1002762651 6:214053-214075 GGGATGGATGGGGAGCTGGAAGG - Intergenic
1003060405 6:2858268-2858290 GGGTGGAAGGGGGAGGGGGAGGG - Intergenic
1003593139 6:7452721-7452743 GGGATGGATGGGGAGCTGGAGGG - Intergenic
1003668838 6:8136655-8136677 AGGATGATGGGGGAGGTGGATGG - Intergenic
1004471585 6:15934121-15934143 AGGTTGGAAGGGGAATTGGAAGG - Intergenic
1004695330 6:18027855-18027877 GGTTTCCAGGGAGAGTTGGAGGG + Intergenic
1005280632 6:24270131-24270153 TGTTTGAAAGGGGAGGTGGAGGG - Intronic
1005566240 6:27097431-27097453 GAGTTGAAAGGGAAGTTGGCTGG - Intergenic
1005715643 6:28544552-28544574 GAGTGGAGGGGAGAGTTGGAGGG + Intergenic
1005715654 6:28544578-28544600 AGTTGGAGGGGGGAGTTGGAGGG + Intergenic
1006034078 6:31198257-31198279 GGGTTGGAGGGGGAGGGGAACGG + Intronic
1006088997 6:31616694-31616716 GGGTGGAAGGGGGAAGAGGAAGG - Intronic
1006922389 6:37635323-37635345 AGGTGGAGGGGGGACTTGGAAGG + Exonic
1007240258 6:40419749-40419771 GGGTTAAGGTGGGATTTGGAAGG - Intronic
1007751301 6:44073524-44073546 GGGTGGGAGGGGGAGGAGGAGGG + Intergenic
1007920747 6:45607383-45607405 GGGATGAAGCGGGAGGTGGGAGG + Intronic
1008863239 6:56176916-56176938 GGGAGGAAGGGGGAGGAGGAAGG + Intronic
1010054043 6:71543030-71543052 GGGTTGGTGGGGGAGTTTGCTGG - Intergenic
1011329566 6:86188513-86188535 GGGCTGAAGGGGGAGGTGCTTGG + Intergenic
1013252752 6:108350516-108350538 GGGTTGATGTATGAGTTGGAGGG + Intronic
1014158282 6:118137477-118137499 GGGGTGAACTGGGAGTAGGAGGG - Intronic
1015098007 6:129440428-129440450 GGGTTGGGGTGGGGGTTGGAGGG - Intronic
1015181806 6:130368791-130368813 GGGTTGCAGAGGGACCTGGATGG + Intronic
1015203021 6:130603664-130603686 GGCTTGAAAGGGGAGCTGGGTGG - Intergenic
1015349002 6:132195026-132195048 GGGATGGACGGGGAGCTGGAAGG + Intergenic
1015407429 6:132853704-132853726 GGGTTGCAGTGGGACATGGAAGG - Intergenic
1015715679 6:136189698-136189720 GGGAGGAAGGGGGAGTAGGGAGG - Intronic
1015920889 6:138265663-138265685 TGGTTGAAGGAGGATTTGGGTGG - Intronic
1016312501 6:142749234-142749256 GGGTAGAAGAGGAAGTTTGAGGG - Intergenic
1016532793 6:145076533-145076555 GGGATGTATGGGGAGCTGGAAGG + Intergenic
1016542903 6:145186345-145186367 GCGTTGGAGGGGTAGTTGCAGGG + Intergenic
1017158353 6:151342034-151342056 GGCTTGAAAGGGGAGTCGGGGGG + Intronic
1017258384 6:152360243-152360265 GGGCTGCAAGGGGAGTTTGATGG - Intronic
1017446600 6:154511755-154511777 GGGTTGGGGGGGGTGTTGGGGGG - Intergenic
1018962259 6:168457347-168457369 GTGTTGAAGGTGGGGTTGGATGG - Intronic
1019045666 6:169143470-169143492 GGGATGGATGGGGAGCTGGAAGG + Intergenic
1019345392 7:527177-527199 GGGTGGGAGGGGGAGGAGGAAGG + Intergenic
1019665987 7:2252616-2252638 AGGGTGAAGGGGGGGCTGGAGGG - Exonic
1020035111 7:4959534-4959556 TGGTAGTAGGGGGAGTGGGAAGG + Intergenic
1020240140 7:6388057-6388079 GTGTTGAAGGGGGAATGGGAGGG + Intronic
1020417349 7:7961105-7961127 GGGTTGGAGGGGGCGATGGTGGG + Intronic
1020547681 7:9554385-9554407 GAATGGAAGGGGGAGTTGGATGG - Intergenic
1022784444 7:33624322-33624344 GGGTTGAGGGTGGAGGTGGGTGG - Intergenic
1023991538 7:45131868-45131890 GGGGTGCAGGGGCAGTTTGAAGG - Intergenic
1024071736 7:45792008-45792030 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1024072567 7:45798759-45798781 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1024213756 7:47228881-47228903 GGGTTGTAGGTGGAGGTGGGCGG - Intergenic
1024650765 7:51401423-51401445 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025054886 7:55757003-55757025 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025132959 7:56387229-56387251 GGAGGGAAGGGGGAGGTGGAGGG - Intergenic
1025184595 7:56847652-56847674 GGTGGGAAGGGGGAGGTGGAGGG - Intergenic
1025198675 7:56949338-56949360 GGGTTGAGGGAGGAGGAGGAAGG - Intergenic
1025673273 7:63627593-63627615 GGGTTGAGGGAGGAGGAGGAAGG + Intergenic
1025687334 7:63729316-63729338 GGTGGGAAGGGGGAGGTGGAGGG + Intergenic
1025909519 7:65817114-65817136 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1025911032 7:65828837-65828859 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1026530067 7:71189523-71189545 GGAGAGAAGGGGCAGTTGGAGGG + Intronic
1026679041 7:72451396-72451418 TGGGGGAAGGGGGAGTAGGAGGG + Intergenic
1027782749 7:82540056-82540078 TGGTAGAAGTGGGAGTTTGAAGG - Intergenic
1028216641 7:88140948-88140970 GGGTTTTATGGGGAGGTGGAGGG + Intronic
1028938459 7:96492229-96492251 GGGTTGAAGGGAGAGGGGAATGG - Intronic
1029673097 7:102047478-102047500 TGGATGAAGGGAGAGATGGAGGG + Intronic
1030124477 7:106141489-106141511 GGGGAGAAGGGGGAGGTAGAGGG - Intergenic
1030124490 7:106141518-106141540 GGGGAGAAGGGGGAGGTAGAGGG - Intergenic
1030124537 7:106141623-106141645 GGGGAGAAGGGGGAGGTAGAGGG - Intergenic
1031952525 7:127906934-127906956 GAGTTTAAGGGGGAATTGGTGGG - Intronic
1032048353 7:128629614-128629636 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1032049954 7:128642437-128642459 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1032059591 7:128713415-128713437 GGTTTGCAGGGGAAGTAGGAAGG + Intronic
1033573312 7:142655515-142655537 GGGATGGATGGGGAGCTGGAAGG - Intergenic
1034203523 7:149296701-149296723 GGGTTGAGTGGGGAGGAGGAGGG - Intronic
1034473473 7:151269162-151269184 ATGGTGAAGGGGGAGTTAGAAGG + Intronic
1034679551 7:152918302-152918324 GGGGTGAATGGGGAGGTAGATGG - Intergenic
1035317461 7:158005627-158005649 GGGGTGCAGGGGGAGGTGCAGGG + Intronic
1035518785 8:259497-259519 TGGTAGAAGGGGGAGCTGGCAGG - Intergenic
1036213030 8:6858001-6858023 GGGATGAAGGTGGAATGGGAGGG - Intergenic
1036255890 8:7206410-7206432 GGGTTGAAGGGATAAATGGATGG + Intergenic
1036361597 8:8081089-8081111 GGGTTGAAGGGATAAATGGATGG - Intergenic
1036561552 8:9903788-9903810 GGGTGGAAGTGGGAGACGGAGGG + Intergenic
1036654734 8:10670885-10670907 GGGTTGAAGAGGGATCTGGAGGG + Intronic
1036722422 8:11188991-11189013 GGGGATGAGGGGGAGTTGGATGG - Intronic
1036968624 8:13328995-13329017 GAGTTGAAGAGGAAGCTGGAGGG + Intronic
1037406333 8:18546786-18546808 GGGTTGAGGTGGGGGTTGGAGGG - Intronic
1037947928 8:23000760-23000782 GGATTGAATGGAGAATTGGAAGG - Intronic
1038054128 8:23842313-23842335 AAGTTTAAGGGGGAATTGGAGGG + Exonic
1038319274 8:26513392-26513414 GGGGTGACGGGGGAGTGGGGGGG - Intronic
1039159262 8:34598588-34598610 GGGTAGAAGGGGGAGTAGTAAGG - Intergenic
1040584508 8:48726773-48726795 GGGTTGATGGGTGAGGTGGGTGG - Intronic
1041413942 8:57587017-57587039 GGGTGGAAGGGGAAGTAGAAAGG + Intergenic
1042192494 8:66201629-66201651 GGGGTGAAGGAAAAGTTGGATGG + Intergenic
1043815104 8:84792272-84792294 GGGATGGATGGGGAGATGGAAGG + Intronic
1043842204 8:85120607-85120629 GGGTTGAGGGTGGAGGTAGAAGG - Intronic
1043919180 8:85961796-85961818 GGATGGAAGGGGGAGCTGCAAGG - Intergenic
1044146809 8:88725884-88725906 GGGTTGAAGGGGTTGTTGAGGGG + Intergenic
1044698003 8:94942350-94942372 GGGATGAGGGGTGAGTAGGAGGG - Intronic
1046417764 8:113938753-113938775 GGGTTGAACGGGGATGTGGTGGG + Intergenic
1046708313 8:117480131-117480153 GTGGTGAAGGGGGAGGTGGGAGG + Intergenic
1047555357 8:125923494-125923516 GGGTTGAGGCTGGAGTGGGAAGG - Intergenic
1047794148 8:128236710-128236732 GTGTTGAGGGGTGAGTGGGAAGG + Intergenic
1048648695 8:136450938-136450960 AGGGTGGATGGGGAGTTGGAAGG + Intergenic
1048959004 8:139560249-139560271 GGGTTGAGGGAGTAGGTGGAGGG - Intergenic
1049223546 8:141438854-141438876 GGGATGAATGGGTAGATGGATGG + Intergenic
1049356737 8:142192847-142192869 GGGATGAAGAGGGAGTGGGAGGG + Intergenic
1050388542 9:5113564-5113586 GGGATCAAGGGGAAGATGGATGG - Intronic
1051263475 9:15288541-15288563 GGGATGAATGGGGAGCTGGAAGG - Intronic
1052112740 9:24608950-24608972 GGGTAGAAGGGGGAGGGAGATGG - Intergenic
1052212873 9:25928310-25928332 GGGTTGATGGGGCAGTTGATGGG - Intergenic
1052420461 9:28236738-28236760 GGGTAGTAGGGGGTGTAGGAAGG + Intronic
1052523901 9:29587378-29587400 GGGTTGGAGGTGGTGGTGGAGGG + Intergenic
1053028647 9:34755052-34755074 GGCTGGGAGGGGTAGTTGGAGGG + Intergenic
1053159089 9:35801062-35801084 GGGTTGAAAGTGGAGCTGAAGGG - Exonic
1054874431 9:70080588-70080610 GGTTTGCAGGGGCAGTTGGTTGG + Intronic
1057068270 9:92074678-92074700 GAGTTGTAAGGGGAGTTGGTAGG - Intronic
1057686185 9:97237313-97237335 GGGCAGAATGGGGAGCTGGAGGG - Intergenic
1058484840 9:105433593-105433615 GGGTGGCAGGGGCAGTGGGAGGG - Intronic
1058532017 9:105915573-105915595 TAGTTGAAGGGAGAGTTGAAGGG + Intergenic
1058944329 9:109841964-109841986 GGGATGGAGGGGAAGTTGGAGGG + Intronic
1060076154 9:120592238-120592260 GGGATGGATGGGGAGCTGGAAGG + Intergenic
1060824360 9:126679490-126679512 TGGTTGAAGGGGTGGGTGGATGG + Intronic
1062167918 9:135117589-135117611 GGGCTGAAGGGGGCCTTCGAAGG - Intronic
1062212900 9:135374130-135374152 GAGGTGGAGGGGGAGTTGGGGGG - Intergenic
1062359942 9:136182930-136182952 GGGCTGAAGGGTGAGAAGGAAGG + Intergenic
1062498610 9:136842991-136843013 GGGTGGAGGGGGGAGATGGGGGG + Intronic
1062570284 9:137181806-137181828 GGGCTGACGGGGGACTCGGACGG - Exonic
1062751961 9:138261871-138261893 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1062753563 9:138274652-138274674 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1203576075 Un_KI270745v1:9431-9453 GGAGGGAAGGGGGAGGTGGAGGG + Intergenic
1185848058 X:3458285-3458307 GGGTTGCAGGGAGAGGAGGATGG - Intergenic
1186864624 X:13707334-13707356 GGGGAGAAGGGAGAGTTGGAGGG + Intronic
1187340166 X:18413993-18414015 GGCTGGAGGGGGGAGCTGGAGGG - Intergenic
1187611358 X:20947258-20947280 GGGTTTAAGGGGGACATGAAAGG - Intergenic
1187934335 X:24321270-24321292 GGGATGAAGGGGGAGGTGTGGGG + Intergenic
1188034181 X:25297993-25298015 GGGTGGAGGGAGGAGTTGGGGGG + Intergenic
1188873548 X:35402537-35402559 GGGTTTATGTGGAAGTTGGAAGG - Intergenic
1189432506 X:40960111-40960133 GGGCTGCAGGGGGTGTTAGAGGG + Intergenic
1190806329 X:53840944-53840966 GAGGTGAAGGGGGAGTGGGGAGG + Intergenic
1191922157 X:66268436-66268458 GGGTGGAAGGGGGATTTAGATGG + Exonic
1192195037 X:69022337-69022359 GGGCGGAAGGGGGACATGGAGGG + Intergenic
1192326050 X:70133353-70133375 GGGGTGAAGGGGGAAGAGGACGG + Intergenic
1192486713 X:71533730-71533752 GAGATGAAGGAGGAGATGGAGGG - Intronic
1193221943 X:78935902-78935924 GGGTTGAAGGGGGAGAAAGTTGG - Intergenic
1193250669 X:79288147-79288169 GGGCTGAAGGGGGAGGAAGATGG + Intergenic
1194261430 X:91700241-91700263 GGGTTGAAGGGGGAGGAAGCTGG - Intergenic
1194763072 X:97816987-97817009 GGGGTGGATGGGGAGCTGGAAGG + Intergenic
1195917596 X:109951068-109951090 GGGGGCAAGGGGGAGTGGGATGG + Intergenic
1196860394 X:120021938-120021960 GGGATGAAGCGGCAGTTGGTGGG - Intergenic
1196866813 X:120077866-120077888 GCGTGGGAGGGGGAGTAGGATGG + Intergenic
1196876286 X:120158415-120158437 GCGTGGGAGGGGGAGTAGGATGG - Intergenic
1198132346 X:133709374-133709396 GGGCTGAAGGTGGAGTTGGGTGG + Intronic
1198783163 X:140258738-140258760 GAGTTGAAGGGGGATGTGGTGGG + Intergenic
1198933909 X:141886945-141886967 GAGTTGAAGGGGGATGTGGTGGG - Intronic
1198997151 X:142586048-142586070 GGGGGGAAGGGGGAGGGGGAAGG + Intergenic
1200154966 X:153970443-153970465 GGGGAGAAGGGGGAGGGGGACGG + Intronic