ID: 958814582

View in Genome Browser
Species Human (GRCh38)
Location 3:98901581-98901603
Sequence GCCGCGGAGGACGGCCGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 303}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958814569_958814582 24 Left 958814569 3:98901534-98901556 CCAGGCCGGAGCGCAGGGGAGGG 0: 1
1: 1
2: 13
3: 319
4: 11409
Right 958814582 3:98901581-98901603 GCCGCGGAGGACGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 18
4: 303
958814573_958814582 19 Left 958814573 3:98901539-98901561 CCGGAGCGCAGGGGAGGGGAGGG 0: 1
1: 1
2: 10
3: 132
4: 784
Right 958814582 3:98901581-98901603 GCCGCGGAGGACGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 18
4: 303
958814567_958814582 25 Left 958814567 3:98901533-98901555 CCCAGGCCGGAGCGCAGGGGAGG 0: 1
1: 0
2: 8
3: 331
4: 14328
Right 958814582 3:98901581-98901603 GCCGCGGAGGACGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 18
4: 303
958814566_958814582 26 Left 958814566 3:98901532-98901554 CCCCAGGCCGGAGCGCAGGGGAG 0: 1
1: 0
2: 4
3: 194
4: 4582
Right 958814582 3:98901581-98901603 GCCGCGGAGGACGGCCGCGGCGG 0: 1
1: 0
2: 0
3: 18
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958814582 Original CRISPR GCCGCGGAGGACGGCCGCGG CGG Exonic