ID: 958821421

View in Genome Browser
Species Human (GRCh38)
Location 3:98977960-98977982
Sequence GGTTTTTTTAGACCATGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958821414_958821421 22 Left 958821414 3:98977915-98977937 CCTCTGATTTTTCCAAATTTGAG No data
Right 958821421 3:98977960-98977982 GGTTTTTTTAGACCATGATCTGG No data
958821418_958821421 10 Left 958821418 3:98977927-98977949 CCAAATTTGAGGGGTCTTTTCTA No data
Right 958821421 3:98977960-98977982 GGTTTTTTTAGACCATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958821421 Original CRISPR GGTTTTTTTAGACCATGATC TGG Intergenic
No off target data available for this crispr