ID: 958821764

View in Genome Browser
Species Human (GRCh38)
Location 3:98982662-98982684
Sequence CTTTGTGACCAGTATGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958821762_958821764 30 Left 958821762 3:98982609-98982631 CCAGCAGTGACTTCGAGTACCAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 958821764 3:98982662-98982684 CTTTGTGACCAGTATGTAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 146
958821763_958821764 11 Left 958821763 3:98982628-98982650 CCAGCTTTCAAATTTATTTGACA 0: 1
1: 0
2: 1
3: 45
4: 360
Right 958821764 3:98982662-98982684 CTTTGTGACCAGTATGTAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958821764 Original CRISPR CTTTGTGACCAGTATGTAGA AGG Intergenic
900981381 1:6048032-6048054 TTTTGTGGCCAGGATTTAGAGGG - Intronic
902446857 1:16472372-16472394 CTTTGTAGCCAGTATGTAGTTGG + Intergenic
903086857 1:20868878-20868900 CTGAGTGACCTGTATGTGGATGG - Intronic
903617339 1:24670241-24670263 GCTGGTGACCAGTTTGTAGACGG - Exonic
905777202 1:40676295-40676317 CTTTCTGAACACTGTGTAGAGGG + Intergenic
906510649 1:46408714-46408736 CTGTGGGACAAGTATATAGAGGG + Intronic
908020105 1:59890303-59890325 CTTTGTCAGCAGTATGAAAATGG - Intergenic
909174592 1:72340208-72340230 CTTTGTGAATACTATGAAGAGGG + Intergenic
910753818 1:90664107-90664129 CTTTGTAAGCAGTATATAGTTGG + Intergenic
911173505 1:94795422-94795444 CTTTGTGATCAGTTTTCAGATGG + Intergenic
914087634 1:144467780-144467802 CTTTGTAGCCAGGATGTAGTTGG - Intergenic
914193407 1:145430753-145430775 CTTTGTAGCCAGGATGTAGTTGG - Intergenic
914310979 1:146466425-146466447 CTTTGTAGCCAGGATGTAGTTGG + Intergenic
915738712 1:158101590-158101612 CTTTGGGACGAGTCTGTATAGGG + Intergenic
916520453 1:165558831-165558853 TTTTGTAAGCAGTATGTAGCTGG - Intronic
918199234 1:182251684-182251706 ATTTGTAACCAGAATATAGAAGG + Intergenic
919224610 1:194680069-194680091 CTCTATGACCAGTATGTTAATGG - Intergenic
921006593 1:211099970-211099992 CTTAGTGAGCAGGAGGTAGAGGG - Intronic
922217579 1:223532854-223532876 GTGTGTCACCAGTCTGTAGAGGG - Intergenic
1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG + Intronic
1071730973 10:88248256-88248278 TTTTGAGAACAGTAGGTAGATGG - Intergenic
1072072844 10:91936624-91936646 CTTTCTAACTAGGATGTAGATGG + Intronic
1076369781 10:129945019-129945041 CTCTGTGACCAGATTGTAAAAGG + Intronic
1076560275 10:131358350-131358372 TTTTTTGACCAGTCTGGAGATGG - Intergenic
1087144771 11:94800446-94800468 CTTTGTGGCCAGAATATATAGGG + Intronic
1088923127 11:114276198-114276220 CTTTGAGACCAGTGTCTACATGG + Intronic
1091826688 12:3518112-3518134 CTTTGTGACATGTATGGTGAGGG - Intronic
1092642431 12:10529628-10529650 TTTTGTTACCACTATTTAGAAGG - Intergenic
1094766730 12:33604613-33604635 TTTTGTGAGCAGCATGTAGTTGG - Intergenic
1096926921 12:55157907-55157929 CTTTGTTAACAATATATAGAGGG + Intergenic
1098699705 12:73608670-73608692 CATTGAAAGCAGTATGTAGAGGG + Intergenic
1100467024 12:94855412-94855434 CTTTGTGACTAGCATATAGCTGG - Intergenic
1103258684 12:119565473-119565495 ATTTGTGACCAGAAGTTAGATGG - Intergenic
1105674206 13:22652723-22652745 CTTTGTGATCATTATTTTGAAGG - Intergenic
1106394348 13:29366125-29366147 CTTTGTCAGCAGTATGAAAACGG - Intronic
1109883221 13:68509394-68509416 CTTTCTTCCTAGTATGTAGATGG - Intergenic
1112446410 13:99468573-99468595 CTTTGTGCCAAGTATTGAGATGG + Intergenic
1115947044 14:38673860-38673882 CATTTAGAGCAGTATGTAGAGGG + Intergenic
1116259173 14:42601171-42601193 CTTTGAGACCAGTATAAGGACGG - Intergenic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1124416550 15:29477245-29477267 CTTTGGGGGCAGTAAGTAGAAGG + Intronic
1125489270 15:40134897-40134919 TGTTGTGACAAGTATGTAGAGGG + Intergenic
1131694876 15:94865909-94865931 CTTTGTCACCAGGATATAGTTGG + Intergenic
1135058486 16:19250940-19250962 CTTTTTGACCTTTATGTAAATGG + Intronic
1135515797 16:23132446-23132468 CATTGTGACGAGTGTATAGATGG + Intronic
1136578869 16:31140313-31140335 CTCTGTGTCCTGTATGCAGAGGG - Exonic
1137357646 16:47782027-47782049 TATTGTAAACAGTATGTAGATGG - Intergenic
1137582751 16:49643935-49643957 CTTGGTGACCAGCATGGAGCAGG + Intronic
1141869526 16:86775297-86775319 CTGTGTGACAACTACGTAGAGGG - Intergenic
1142122847 16:88395692-88395714 CTGTGTGACCAGCAAGGAGAAGG + Intergenic
1146278700 17:31531362-31531384 CAATGTGATCAGTTTGTAGAGGG - Intronic
1147132041 17:38415369-38415391 TTTTGTCTCCAGTATGGAGAGGG + Intergenic
1148184505 17:45632014-45632036 CTTTGTCCCCAGTTTCTAGAAGG - Intergenic
1149693443 17:58597786-58597808 CATGGTGACCAGTACATAGAAGG - Intronic
1150338764 17:64348892-64348914 CTCTGTTACCAGGATGTGGAGGG + Intronic
1150757699 17:67930513-67930535 CTTTGTTACTAGTATGGAAAAGG + Intronic
1152468909 17:80480177-80480199 GTTAGTGGCCAGTATGGAGAGGG + Intergenic
1156135674 18:34034350-34034372 TTTTGTGAGCAGTTTGTAGTTGG - Intronic
1158182894 18:54737929-54737951 CTTTGTCACAAGTTTCTAGAAGG - Intronic
1158621243 18:59034408-59034430 CTTTGTGCCCACAATGTTGAAGG + Intergenic
1158854569 18:61530130-61530152 CTTTGTAACCAAAATGCAGAGGG - Intronic
1160869626 19:1271317-1271339 CTCTGTCTCCAGTCTGTAGATGG + Exonic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1168410921 19:56140046-56140068 CTTTGTGACCAGTTTGCCCACGG - Intronic
927057514 2:19379770-19379792 CTTTGTTTCCACTATGGAGATGG + Intergenic
932641285 2:73449804-73449826 CTTTGTGAGTAGAAAGTAGACGG - Exonic
935654587 2:105410946-105410968 CCTTGGGACCAGTACATAGAAGG + Intronic
936642957 2:114336070-114336092 CATTGAAAGCAGTATGTAGAGGG + Intergenic
939201271 2:139038098-139038120 CTTTGAAACCAGTATTTAAAAGG + Intergenic
939847900 2:147269793-147269815 CTTTGTCAGCAGCATGAAGACGG - Intergenic
940584789 2:155633198-155633220 CTTTGTTCCCAGCAAGTAGATGG + Intergenic
941154350 2:161957219-161957241 CTTTATGACCAGTATTCTGAAGG + Exonic
943934222 2:193894222-193894244 CTTTGTGACCATGATGAATAGGG + Intergenic
944590548 2:201213422-201213444 TGTTGTGACAAGTATATAGAGGG + Intronic
945181613 2:207097467-207097489 CTTTGTCACCTGTATGTCCAGGG + Intronic
945299671 2:208204345-208204367 CTTTGTTGCCAGGATGTGGAAGG + Intergenic
946215509 2:218180493-218180515 CTTTGTGACTGGTATGAAGTGGG - Intergenic
946510729 2:220353247-220353269 CTTTCTGAACAGAATATAGAGGG + Intergenic
947318347 2:228889261-228889283 CTTTGTGACTCATATGTACATGG - Intronic
1169286093 20:4308456-4308478 CTTTGTGCCCAGTTTGTTGTTGG - Intergenic
1170247885 20:14244443-14244465 TTTAGTGGTCAGTATGTAGATGG + Intronic
1174454666 20:50640664-50640686 CTTTTTGACCGTTTTGTAGAGGG - Intronic
1174472134 20:50769058-50769080 CTTTTTGACCATTTTGTAGAGGG + Intergenic
1175328628 20:58147528-58147550 CTTTGTGACCATTTTGCAGAAGG - Intergenic
1178510685 21:33202565-33202587 TTTTGTGACCACAATGCAGAAGG - Intergenic
1180133255 21:45841971-45841993 CTTTGTCACCAGTATGTGCTGGG + Intronic
1180678252 22:17603876-17603898 CTGTGTGACCAGTGTGGATAGGG - Intronic
1181064983 22:20301244-20301266 CCTTGTGGCCAGGATGTAGTGGG + Intergenic
951552366 3:23886682-23886704 CTTTGTAACCAGTTAGCAGAGGG + Intronic
954819237 3:53310837-53310859 CTTTGTTATCAGAATGTAGAAGG + Intronic
958821764 3:98982662-98982684 CTTTGTGACCAGTATGTAGAAGG + Intergenic
959008929 3:101051596-101051618 CTTTGTGAACACTTTGTAAAAGG - Intergenic
960039856 3:113139838-113139860 CTTGGTTACCAGTATATAGGAGG + Intergenic
960048730 3:113221195-113221217 CGTTGGGAGCAGTCTGTAGAAGG + Intronic
964270291 3:154948137-154948159 CATTGAAACCAGTGTGTAGAGGG + Intergenic
965342734 3:167510610-167510632 ATTTGTGAGAAGTAGGTAGATGG - Intronic
965961044 3:174428988-174429010 CTCTGTGCCCATTATGTAGTAGG - Intergenic
969196073 4:5564954-5564976 CTTTGTGAACAGTAGCTATAAGG + Intronic
973683240 4:53342948-53342970 CATTTAAACCAGTATGTAGAGGG + Intronic
978968856 4:114776954-114776976 CTTTGTACCCAGTTTGTTGATGG + Intergenic
979401005 4:120249471-120249493 CTTTGTGAACTTTATGTAAATGG + Intergenic
979650887 4:123129811-123129833 CTTTGAGACATGTAAGTAGATGG - Intronic
981474248 4:145172265-145172287 GGTAGTGACCAGTGTGTAGAAGG + Intronic
981947383 4:150363592-150363614 CTGTATAACCAGTATGTAGTAGG + Intronic
983741319 4:171138311-171138333 CTTTGTCACCAATAGGTAGAAGG + Intergenic
986702722 5:10427302-10427324 CATTGTGCCCAGTGTGGAGAAGG - Intronic
988636979 5:32995319-32995341 CTTTGGGAACAGAAAGTAGATGG - Intergenic
991307141 5:65189372-65189394 CTTTGTGACCAGAAAGGAAAGGG - Intronic
993798486 5:92300120-92300142 CATTGAAAGCAGTATGTAGAGGG - Intergenic
995633537 5:114160155-114160177 CATTCTAAGCAGTATGTAGAGGG - Intergenic
997933219 5:138088994-138089016 CTTTGTGGACAGTTTGGAGAAGG + Exonic
1003754498 6:9101315-9101337 GTTTTTGAGCAGTATTTAGAAGG - Intergenic
1003796558 6:9612134-9612156 GTTTGTGACGAGTGTGCAGAAGG + Intronic
1005809070 6:29502535-29502557 CTTTGTGCCCAGGAGGGAGAGGG + Intergenic
1008074062 6:47127395-47127417 GTTTGTGACCAGTGTGAAGCAGG - Intergenic
1008499252 6:52164380-52164402 CTTTGTGACAAGGAGGAAGAGGG + Intergenic
1009716031 6:67396910-67396932 ATTTGTTACCAGGATATAGAGGG + Intergenic
1012166484 6:95960023-95960045 CATTTTGACCAGTATGTCAATGG - Intergenic
1013281674 6:108643641-108643663 CTTTTTGACCAGAATGTAAGAGG + Intronic
1014250952 6:119115162-119115184 CTTTGTGACCAGTTTAAATATGG - Intronic
1014896738 6:126910417-126910439 ATTTAAGAACAGTATGTAGAAGG + Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018076923 6:160225573-160225595 CCTTGAGACCAGTATGTAAGGGG - Intronic
1020913628 7:14164928-14164950 CTTTGTGACTCGTAGGTAGCAGG + Intronic
1028444637 7:90907145-90907167 CATTGCAACCAGTTTGTAGATGG + Intronic
1028977906 7:96934321-96934343 CTCAATGACCAGTATATAGAAGG + Intergenic
1032860981 7:135879025-135879047 TTTTTTGCCCAGTATGAAGATGG + Intergenic
1033559882 7:142521030-142521052 CTTACTGACCAGGATGCAGAAGG - Intergenic
1034944366 7:155252449-155252471 CTGTGTGAACAGTTTGTAGGAGG - Intergenic
1037715202 8:21391662-21391684 CTTTATGACCAGTTTTTATATGG - Intergenic
1040707893 8:50151561-50151583 CATTTAAACCAGTATGTAGAGGG - Intronic
1041556776 8:59165943-59165965 CTTTGTGACCAGTTGGATGAAGG + Intergenic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1044895116 8:96883464-96883486 CTTTGTTACCAAGATGTAAAAGG + Intronic
1047665438 8:127086603-127086625 GCTGGTGACCAGTTTGTAGACGG + Intergenic
1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG + Intronic
1050165192 9:2758064-2758086 CTTTGTGATGAGCATGAAGAAGG - Intronic
1051216705 9:14805388-14805410 CTTTTTAACCAGTATGCACAGGG + Intronic
1051390962 9:16562584-16562606 TTTTATTAGCAGTATGTAGAAGG - Intronic
1053714496 9:40873584-40873606 CTTTGTGATGTGTGTGTAGATGG + Intergenic
1054845407 9:69791233-69791255 CTTTCTTACCAGCATTTAGATGG + Intergenic
1057256577 9:93553745-93553767 CTCTGTGACCCGTCTGTACAAGG + Intronic
1059619255 9:115985265-115985287 CTTTTTGATCATTATGTAGAAGG - Intergenic
1187047282 X:15659754-15659776 CTCTTTGGCCTGTATGTAGATGG - Intronic
1190468873 X:50755416-50755438 ATTTTTGCCCAGTCTGTAGAAGG - Intronic
1191058680 X:56271451-56271473 CTTGGAGACCACTATGGAGAAGG - Intronic
1195412932 X:104588309-104588331 CTTTCTGAGCAGCATGTACAAGG + Intronic
1196289690 X:113924478-113924500 CTTTATGACCAGAATATACAAGG - Intergenic
1197538801 X:127728146-127728168 CTGTGTGAACCATATGTAGATGG + Intergenic
1197991575 X:132324339-132324361 CATTTAAACCAGTATGTAGAGGG + Intergenic
1198802423 X:140461267-140461289 TTTGGTGACCAGTATATAGTAGG + Intergenic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic
1199491132 X:148402064-148402086 CTTTATCAGCAGTATGTAAATGG - Intergenic
1201275536 Y:12294343-12294365 CTTTGTGATCAGTGCTTAGAGGG + Intergenic