ID: 958823872

View in Genome Browser
Species Human (GRCh38)
Location 3:99007177-99007199
Sequence CAGTCACATCCCCTAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958823872_958823875 -6 Left 958823872 3:99007177-99007199 CCCCTCTCTAGGGGATGTGACTG No data
Right 958823875 3:99007194-99007216 TGACTGTAGAGAATATGCATAGG No data
958823872_958823876 -5 Left 958823872 3:99007177-99007199 CCCCTCTCTAGGGGATGTGACTG No data
Right 958823876 3:99007195-99007217 GACTGTAGAGAATATGCATAGGG No data
958823872_958823877 3 Left 958823872 3:99007177-99007199 CCCCTCTCTAGGGGATGTGACTG No data
Right 958823877 3:99007203-99007225 AGAATATGCATAGGGTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958823872 Original CRISPR CAGTCACATCCCCTAGAGAG GGG (reversed) Intergenic
No off target data available for this crispr