ID: 958827024

View in Genome Browser
Species Human (GRCh38)
Location 3:99042307-99042329
Sequence GGTGCTAGTGTGCACCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958827023_958827024 -5 Left 958827023 3:99042289-99042311 CCAGTAACTGACAATACAGGTGC No data
Right 958827024 3:99042307-99042329 GGTGCTAGTGTGCACCATCCTGG No data
958827020_958827024 19 Left 958827020 3:99042265-99042287 CCTGGAGGCTGAAGAATCAGCCT No data
Right 958827024 3:99042307-99042329 GGTGCTAGTGTGCACCATCCTGG No data
958827019_958827024 22 Left 958827019 3:99042262-99042284 CCACCTGGAGGCTGAAGAATCAG No data
Right 958827024 3:99042307-99042329 GGTGCTAGTGTGCACCATCCTGG No data
958827021_958827024 -1 Left 958827021 3:99042285-99042307 CCTGCCAGTAACTGACAATACAG No data
Right 958827024 3:99042307-99042329 GGTGCTAGTGTGCACCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958827024 Original CRISPR GGTGCTAGTGTGCACCATCC TGG Intergenic
No off target data available for this crispr