ID: 958829146

View in Genome Browser
Species Human (GRCh38)
Location 3:99066645-99066667
Sequence TGAGGCTTTTAAAAATGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958829146_958829150 0 Left 958829146 3:99066645-99066667 CCTACCCATTTTTAAAAGCCTCA No data
Right 958829150 3:99066668-99066690 CACATATCCTGCCTCTTTCATGG No data
958829146_958829153 12 Left 958829146 3:99066645-99066667 CCTACCCATTTTTAAAAGCCTCA No data
Right 958829153 3:99066680-99066702 CTCTTTCATGGCATCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958829146 Original CRISPR TGAGGCTTTTAAAAATGGGT AGG (reversed) Intergenic
No off target data available for this crispr