ID: 958829147

View in Genome Browser
Species Human (GRCh38)
Location 3:99066649-99066671
Sequence TGTGTGAGGCTTTTAAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958829147_958829153 8 Left 958829147 3:99066649-99066671 CCCATTTTTAAAAGCCTCACACA No data
Right 958829153 3:99066680-99066702 CTCTTTCATGGCATCTTCCCAGG No data
958829147_958829150 -4 Left 958829147 3:99066649-99066671 CCCATTTTTAAAAGCCTCACACA No data
Right 958829150 3:99066668-99066690 CACATATCCTGCCTCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958829147 Original CRISPR TGTGTGAGGCTTTTAAAAAT GGG (reversed) Intergenic
No off target data available for this crispr