ID: 958829149

View in Genome Browser
Species Human (GRCh38)
Location 3:99066663-99066685
Sequence AAAGAGGCAGGATATGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958829149_958829153 -6 Left 958829149 3:99066663-99066685 CCTCACACATATCCTGCCTCTTT No data
Right 958829153 3:99066680-99066702 CTCTTTCATGGCATCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958829149 Original CRISPR AAAGAGGCAGGATATGTGTG AGG (reversed) Intergenic
No off target data available for this crispr