ID: 958829150

View in Genome Browser
Species Human (GRCh38)
Location 3:99066668-99066690
Sequence CACATATCCTGCCTCTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958829142_958829150 28 Left 958829142 3:99066617-99066639 CCCCCAGTCTGGCTTTTCTTCTT No data
Right 958829150 3:99066668-99066690 CACATATCCTGCCTCTTTCATGG No data
958829147_958829150 -4 Left 958829147 3:99066649-99066671 CCCATTTTTAAAAGCCTCACACA No data
Right 958829150 3:99066668-99066690 CACATATCCTGCCTCTTTCATGG No data
958829144_958829150 26 Left 958829144 3:99066619-99066641 CCCAGTCTGGCTTTTCTTCTTTA No data
Right 958829150 3:99066668-99066690 CACATATCCTGCCTCTTTCATGG No data
958829148_958829150 -5 Left 958829148 3:99066650-99066672 CCATTTTTAAAAGCCTCACACAT No data
Right 958829150 3:99066668-99066690 CACATATCCTGCCTCTTTCATGG No data
958829146_958829150 0 Left 958829146 3:99066645-99066667 CCTACCCATTTTTAAAAGCCTCA No data
Right 958829150 3:99066668-99066690 CACATATCCTGCCTCTTTCATGG No data
958829143_958829150 27 Left 958829143 3:99066618-99066640 CCCCAGTCTGGCTTTTCTTCTTT No data
Right 958829150 3:99066668-99066690 CACATATCCTGCCTCTTTCATGG No data
958829145_958829150 25 Left 958829145 3:99066620-99066642 CCAGTCTGGCTTTTCTTCTTTAA No data
Right 958829150 3:99066668-99066690 CACATATCCTGCCTCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958829150 Original CRISPR CACATATCCTGCCTCTTTCA TGG Intergenic
No off target data available for this crispr