ID: 958829153

View in Genome Browser
Species Human (GRCh38)
Location 3:99066680-99066702
Sequence CTCTTTCATGGCATCTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958829147_958829153 8 Left 958829147 3:99066649-99066671 CCCATTTTTAAAAGCCTCACACA No data
Right 958829153 3:99066680-99066702 CTCTTTCATGGCATCTTCCCAGG No data
958829148_958829153 7 Left 958829148 3:99066650-99066672 CCATTTTTAAAAGCCTCACACAT No data
Right 958829153 3:99066680-99066702 CTCTTTCATGGCATCTTCCCAGG No data
958829146_958829153 12 Left 958829146 3:99066645-99066667 CCTACCCATTTTTAAAAGCCTCA No data
Right 958829153 3:99066680-99066702 CTCTTTCATGGCATCTTCCCAGG No data
958829149_958829153 -6 Left 958829149 3:99066663-99066685 CCTCACACATATCCTGCCTCTTT No data
Right 958829153 3:99066680-99066702 CTCTTTCATGGCATCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958829153 Original CRISPR CTCTTTCATGGCATCTTCCC AGG Intergenic
No off target data available for this crispr