ID: 958840156

View in Genome Browser
Species Human (GRCh38)
Location 3:99193539-99193561
Sequence CCCGGCAGCAGACTTTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958840153_958840156 29 Left 958840153 3:99193487-99193509 CCTAAAAGCAGCAAGAGAAAAGA 0: 303
1: 527
2: 531
3: 599
4: 1802
Right 958840156 3:99193539-99193561 CCCGGCAGCAGACTTTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958840156 Original CRISPR CCCGGCAGCAGACTTTTCAG TGG Intergenic
No off target data available for this crispr