ID: 958843251

View in Genome Browser
Species Human (GRCh38)
Location 3:99234235-99234257
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958843249_958843251 29 Left 958843249 3:99234183-99234205 CCAAAAGTATTAACTAGCTAATA No data
Right 958843251 3:99234235-99234257 CATTTCATGCTGAAAATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr