ID: 958856318

View in Genome Browser
Species Human (GRCh38)
Location 3:99390509-99390531
Sequence TCTGAAGACCAGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958856318_958856323 11 Left 958856318 3:99390509-99390531 CCTGCTTCCTTCTGGTCTTCAGA No data
Right 958856323 3:99390543-99390565 TTTGTGCTGACCTCTTTGCATGG No data
958856318_958856325 29 Left 958856318 3:99390509-99390531 CCTGCTTCCTTCTGGTCTTCAGA No data
Right 958856325 3:99390561-99390583 CATGGAGATCCCAAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958856318 Original CRISPR TCTGAAGACCAGAAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr