ID: 958856325

View in Genome Browser
Species Human (GRCh38)
Location 3:99390561-99390583
Sequence CATGGAGATCCCAAAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958856321_958856325 -2 Left 958856321 3:99390540-99390562 CCCTTTGTGCTGACCTCTTTGCA No data
Right 958856325 3:99390561-99390583 CATGGAGATCCCAAAGTAACTGG No data
958856322_958856325 -3 Left 958856322 3:99390541-99390563 CCTTTGTGCTGACCTCTTTGCAT No data
Right 958856325 3:99390561-99390583 CATGGAGATCCCAAAGTAACTGG No data
958856318_958856325 29 Left 958856318 3:99390509-99390531 CCTGCTTCCTTCTGGTCTTCAGA No data
Right 958856325 3:99390561-99390583 CATGGAGATCCCAAAGTAACTGG No data
958856319_958856325 22 Left 958856319 3:99390516-99390538 CCTTCTGGTCTTCAGAGCCTATT No data
Right 958856325 3:99390561-99390583 CATGGAGATCCCAAAGTAACTGG No data
958856320_958856325 5 Left 958856320 3:99390533-99390555 CCTATTACCCTTTGTGCTGACCT No data
Right 958856325 3:99390561-99390583 CATGGAGATCCCAAAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958856325 Original CRISPR CATGGAGATCCCAAAGTAAC TGG Intergenic
No off target data available for this crispr