ID: 958860625

View in Genome Browser
Species Human (GRCh38)
Location 3:99441156-99441178
Sequence CCTTCCATAAGCACTCCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958860619_958860625 16 Left 958860619 3:99441117-99441139 CCTTCAAGTCTGAGTTGAATAGC No data
Right 958860625 3:99441156-99441178 CCTTCCATAAGCACTCCCTAGGG No data
958860621_958860625 -9 Left 958860621 3:99441142-99441164 CCTCCTCTGAGAAGCCTTCCATA No data
Right 958860625 3:99441156-99441178 CCTTCCATAAGCACTCCCTAGGG No data
958860620_958860625 -6 Left 958860620 3:99441139-99441161 CCACCTCCTCTGAGAAGCCTTCC 0: 8
1: 37
2: 178
3: 570
4: 1532
Right 958860625 3:99441156-99441178 CCTTCCATAAGCACTCCCTAGGG No data
958860618_958860625 25 Left 958860618 3:99441108-99441130 CCTTATCATCCTTCAAGTCTGAG No data
Right 958860625 3:99441156-99441178 CCTTCCATAAGCACTCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958860625 Original CRISPR CCTTCCATAAGCACTCCCTA GGG Intergenic
No off target data available for this crispr