ID: 958863579

View in Genome Browser
Species Human (GRCh38)
Location 3:99473117-99473139
Sequence AGTCCTTTCAACCACTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958863579_958863582 16 Left 958863579 3:99473117-99473139 CCATTAAAGTGGTTGAAAGGACT No data
Right 958863582 3:99473156-99473178 TCTATAACTGTGCATCCTAAGGG No data
958863579_958863581 15 Left 958863579 3:99473117-99473139 CCATTAAAGTGGTTGAAAGGACT No data
Right 958863581 3:99473155-99473177 CTCTATAACTGTGCATCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958863579 Original CRISPR AGTCCTTTCAACCACTTTAA TGG (reversed) Intergenic