ID: 958867397

View in Genome Browser
Species Human (GRCh38)
Location 3:99517141-99517163
Sequence CCTTTCACTCCCACTCCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958867388_958867397 21 Left 958867388 3:99517097-99517119 CCTCCCTATGCTGGGAGTTTCCC No data
Right 958867397 3:99517141-99517163 CCTTTCACTCCCACTCCTTAGGG No data
958867393_958867397 1 Left 958867393 3:99517117-99517139 CCCAAAACTATCTGGGTATTTCT No data
Right 958867397 3:99517141-99517163 CCTTTCACTCCCACTCCTTAGGG No data
958867389_958867397 18 Left 958867389 3:99517100-99517122 CCCTATGCTGGGAGTTTCCCAAA No data
Right 958867397 3:99517141-99517163 CCTTTCACTCCCACTCCTTAGGG No data
958867390_958867397 17 Left 958867390 3:99517101-99517123 CCTATGCTGGGAGTTTCCCAAAA No data
Right 958867397 3:99517141-99517163 CCTTTCACTCCCACTCCTTAGGG No data
958867394_958867397 0 Left 958867394 3:99517118-99517140 CCAAAACTATCTGGGTATTTCTG No data
Right 958867397 3:99517141-99517163 CCTTTCACTCCCACTCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958867397 Original CRISPR CCTTTCACTCCCACTCCTTA GGG Intergenic
No off target data available for this crispr