ID: 958867969

View in Genome Browser
Species Human (GRCh38)
Location 3:99523420-99523442
Sequence AATTGAGTCTGTGCTGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958867969_958867972 19 Left 958867969 3:99523420-99523442 CCAAAACCAGCACAGACTCAATT No data
Right 958867972 3:99523462-99523484 AAATGTAATTCCCTAACATATGG No data
958867969_958867974 26 Left 958867969 3:99523420-99523442 CCAAAACCAGCACAGACTCAATT No data
Right 958867974 3:99523469-99523491 ATTCCCTAACATATGGAAGAGGG No data
958867969_958867973 25 Left 958867969 3:99523420-99523442 CCAAAACCAGCACAGACTCAATT No data
Right 958867973 3:99523468-99523490 AATTCCCTAACATATGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958867969 Original CRISPR AATTGAGTCTGTGCTGGTTT TGG (reversed) Intergenic
No off target data available for this crispr