ID: 958867970

View in Genome Browser
Species Human (GRCh38)
Location 3:99523426-99523448
Sequence GAGGATAATTGAGTCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958867970_958867972 13 Left 958867970 3:99523426-99523448 CCAGCACAGACTCAATTATCCTC No data
Right 958867972 3:99523462-99523484 AAATGTAATTCCCTAACATATGG No data
958867970_958867973 19 Left 958867970 3:99523426-99523448 CCAGCACAGACTCAATTATCCTC No data
Right 958867973 3:99523468-99523490 AATTCCCTAACATATGGAAGAGG No data
958867970_958867974 20 Left 958867970 3:99523426-99523448 CCAGCACAGACTCAATTATCCTC No data
Right 958867974 3:99523469-99523491 ATTCCCTAACATATGGAAGAGGG No data
958867970_958867977 30 Left 958867970 3:99523426-99523448 CCAGCACAGACTCAATTATCCTC No data
Right 958867977 3:99523479-99523501 ATATGGAAGAGGGAACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958867970 Original CRISPR GAGGATAATTGAGTCTGTGC TGG (reversed) Intergenic
No off target data available for this crispr