ID: 958867971

View in Genome Browser
Species Human (GRCh38)
Location 3:99523445-99523467
Sequence ACATTTAAGAGCGAGTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958867971_958867978 12 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867978 3:99523480-99523502 TATGGAAGAGGGAACATTTTGGG No data
958867971_958867979 25 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867979 3:99523493-99523515 ACATTTTGGGAAAACGTCAATGG No data
958867971_958867980 26 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867980 3:99523494-99523516 CATTTTGGGAAAACGTCAATGGG No data
958867971_958867972 -6 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867972 3:99523462-99523484 AAATGTAATTCCCTAACATATGG No data
958867971_958867973 0 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867973 3:99523468-99523490 AATTCCCTAACATATGGAAGAGG No data
958867971_958867977 11 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867977 3:99523479-99523501 ATATGGAAGAGGGAACATTTTGG No data
958867971_958867974 1 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867974 3:99523469-99523491 ATTCCCTAACATATGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958867971 Original CRISPR ACATTTAAGAGCGAGTAATG AGG (reversed) Intergenic
No off target data available for this crispr