ID: 958867972

View in Genome Browser
Species Human (GRCh38)
Location 3:99523462-99523484
Sequence AAATGTAATTCCCTAACATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958867971_958867972 -6 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867972 3:99523462-99523484 AAATGTAATTCCCTAACATATGG No data
958867970_958867972 13 Left 958867970 3:99523426-99523448 CCAGCACAGACTCAATTATCCTC No data
Right 958867972 3:99523462-99523484 AAATGTAATTCCCTAACATATGG No data
958867969_958867972 19 Left 958867969 3:99523420-99523442 CCAAAACCAGCACAGACTCAATT No data
Right 958867972 3:99523462-99523484 AAATGTAATTCCCTAACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958867972 Original CRISPR AAATGTAATTCCCTAACATA TGG Intergenic
No off target data available for this crispr