ID: 958867974

View in Genome Browser
Species Human (GRCh38)
Location 3:99523469-99523491
Sequence ATTCCCTAACATATGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
958867971_958867974 1 Left 958867971 3:99523445-99523467 CCTCATTACTCGCTCTTAAATGT No data
Right 958867974 3:99523469-99523491 ATTCCCTAACATATGGAAGAGGG No data
958867970_958867974 20 Left 958867970 3:99523426-99523448 CCAGCACAGACTCAATTATCCTC No data
Right 958867974 3:99523469-99523491 ATTCCCTAACATATGGAAGAGGG No data
958867969_958867974 26 Left 958867969 3:99523420-99523442 CCAAAACCAGCACAGACTCAATT No data
Right 958867974 3:99523469-99523491 ATTCCCTAACATATGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
958867974 Original CRISPR ATTCCCTAACATATGGAAGA GGG Intergenic
No off target data available for this crispr